Article Per Year (5 Year)
p-Index From 2019 - 2024
0.23
P-Index
This Author published in this journals
All Journal PROSIDING SEMINAR NASIONAL Squalen Bulletin of Marine and Fisheries Postharvest and Biotechnology
Ayu Rahmawati Sulistyaningtyas
Unknown Affiliation
Agriculture, Biological Sciences & Forestry Biochemistry, Genetics & Molecular Biology Education Environmental Science Immunology & microbiology

Published : 3 Documents Claim Missing Document
Claim Missing Document
Check
Articles

Found 3 Documents
Search

 1 
PENTINGNYA PENGOLAHAN BASAH (WET PROCESSING) BUAH KOPI ROBUSTA (Coffea robusta Lindl.ex.de.Will) UNTUK MENURUNKAN RESIKO KECACATAN BIJI HIJAU SAAT COFFEE GRADING Ayu Rahmawati Sulistyaningtyas
PROSIDING SEMINAR NASIONAL & INTERNASIONAL 2017: Prosiding Seminar Nasional Publikasi Hasil-Hasil Penelitian dan Pengabdian Masyarakat
Publisher : Universitas Muhammadiyah Semarang

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (401.271 KB)

Abstract

Coffee plant (Coffea.sp) is one of the main commodities in Indonesia. The types of arabica coffee (Coffea arabica) androbusta coffee (Coffea robusta) are the most widely cultivated species. In Indonesia, coffee plantations began to grow rapidly so that potential for the development of domestic coffee. The development of the people's coffee plant required support of various factors such as availability of facilities, methods of processing and postharvest handling which suitable for the coffee plantations to produce quality coffee beans according to Indonesian National Standard (SNI).Coffee fruit should be handled quickly into a more stable form to be safe to store for a certain period of time. The seedquality criteria covering physical aspect, taste and hygiene and uniformity and consistency aspect is determined by thetreatment at each stage of production process. The result of overview study showed that  the handling of harvest, postharvest and coffee processing at farmers level should be done effectively and efficiently. During pulping process, coffee skin has exfoliated from their fruit. This process caused grean bean rubbing against pulper tools. So, wet processing may potentially reduced a risk of defect robusta green beans. In conclusion, wet processing robusta fruit (Coffea robusta Lindl.Ex.De.Will) is important to reduce the risk of green seed defects during coffee grading process.Keywords: Coffea, robusta, biji,pengolahan,basah, resiko, cacat
PHOTOCATALYTIC DEGRADATION Cr (VI) BY ZSM-5 IMPREGNATED TiO2 IN VARIOUS UV-IRRADIATION TIME Faridah Faridah; Ana Hidayati Mukaromah; Ayu Rahmawati Sulistyaningtyas
PROSIDING SEMINAR NASIONAL & INTERNASIONAL 2018: SEMINAR NASIONAL PENDIDIKAN SAINS DAN TEKNOLOGI
Publisher : Universitas Muhammadiyah Semarang

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (95.425 KB)

Abstract

Chromium is considered as one of the most common ubiquitous pollutants in aquatic environment. There were qualities standard about Chromium content in drinking water and fresh water. Oxidation of Chromium were Cr (II), Cr (III) and Cr (VI).  Among these, Cr (VI) is considered as the most toxic form because it readily passes cellular membranes and then reduced to Cr (III). TiO2    as catalyst can activated and modified zeolites with active metal materials i.e ZSM-5 impregnated TiO2. Main objective of study was to determine decreased percentage of Cr (VI) in water by using ZSM-5 impregnated TiO2  based on UV irradiation time. This study was used Completely Randomized Design i.e length of UV irradiation. Result  showed Cr (VI) content was decreasing with various length  of  UV  irradiation  in  15;30;45;60;75  minutes,  respectively  is  17.01; 17.99; 18.99; 28,73; 36, 20%. The highest percentage decrease of Cr (VI) ion content during 75 minute UV irradiation is 39,42%. Chromium (VI) content could be solved with zeolite ZSM-5 impregnated TiO2  by using photocatalytic method. In conclusion, the longer UV   irradiation time caused higher of decreased percentage Cr (VI). Keywords: Chromium,  Photocatalytic, Zeolite, Impregnated
Streptolysin Encoding Genes sagC and sagD as Biomarkers of Fish Pathogen Streptococcus iniae: An In Silico Study Stalis Norma Ethica; Sri Darmawati; Sri Sinto Dewi; Nurrahman Nurrahman; Ayu Rahmawati Sulistyaningtyas
Squalen, Buletin Pascapanen dan Bioteknologi Kelautan dan Perikanan Vol 15, No 1 (2020): May 2020
Publisher : Research and Development Center for Marine and Fisheries Product Processing and Biotechnol

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (576.394 KB) | DOI: 10.15578/squalen.v15i1.416

Abstract

Streptococcus iniae has been notorious as a serious tilapia fish pathogen leading to many disease outbreaks in warm water marine aquaculture. An in silico investigation about the potential of virulence genes of S. iniae, sagC and sagD, as biomarkers of the bacterial species, has been carried out. The aim was to determine bacterial biomarkers, which are important to facilitate early rapid diagnosis of S. iniae streptococcal infection in fish and also in humans. First, specific primers were designed from sagC and sagD genes of S. iniae SF1 genomic DNA using Primer3Plus. Next, in silico PCR (Polymerase Chain Reaction) analysis was carried out using the newly designed primers and 117 genomic DNA of streptococci (all species) retrieved from the database. Primers designed from sagC and sagD genes (SagCF: ‘5- TGCTGACCTCCTAAAAGGGC -3’ and SagCR: ‘5- CTATGCGGCGGGTTTAAGGT -3’ as well as SagDF: 5’- GCCAATCCAATCCTGTCATGC -3’ and SagDR: 5’- TGCAGCTTCCATAACCCCTC -3’) could result in a single band of each matching to 558-bp and 590-bp PCR products only from S. iniae. From 116 other streptococcal genomes studied using similar primers have resulted in no amplicon bands. A further check showed that the amplicons were truly part of sagC and sagD genes of S. iniae. These results showed that sagC and sagD genes appeared to be biomarkers of S. iniae, which are potential to be used to facilitate rapid diagnostic of the pathogenic bacterium.
Co-Authors Ana Hidayati Mukaromah Faridah Faridah Nurrahman Nurrahman Sri Darmawati Sri Sinto Dewi Stalis Norma Ethica