Article Per Year (5 Year)
p-Index From 2019 - 2024
0
P-Index
This Author published in this journals
All Journal e-Journal BUDIDAYA PERAIRAN Jurnal Natur Indonesia BERITA BIOLOGI LIMNOTEK - Perairan Darat Tropis di Indonesia
Enang Harris
Department of Aquaculture
Agriculture, Biological Sciences & Forestry Biochemistry, Genetics & Molecular Biology Chemical Engineering, Chemistry & Bioengineering Chemistry Environmental Science

Published : 5 Documents Claim Missing Document
Claim Missing Document
Check
Articles

Found 5 Documents
Search

 1 
PENINGKATAN KUALITAS NUTRISI TEPUNG DAUN LAMTORO SEBAGAI PAKAN IKAN DENGAN PENAMBAHAN EKSTRAK ENZIM CAIRAN RUMEN DOMBA Fitriliyani, Indira; Harris, Enang; Mokoginta, Ing; Nahrowi, Nahrowi
BERITA BIOLOGI Vol 10, No 2 (2010)
Publisher : Research Center for Biology-Indonesian Institute of Sciences

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (877.781 KB) | DOI: 10.14203/beritabiologi.v10i2.1965

Abstract

The aim of this experiment is to evaluate the nutrient quality of leucaena leaf meal (LLM) with addition of sheep rumen fluid enzyme for nile tilapia feed and incubated in vitro either for 2 or 24 hours. This experiment was arranged in a completely randomized design with 6 treatments and 3 replications. Those treatments were enzyme levels of 0, 20, 40, 60, 80, and 100 ml/ kg LLM. Results showed that nutrient quality of LLM with addition of sheep rumen fluid enzyme that incubated for 24 hours had the best result compared to that incubated for 2 hours. This finding significantly affected (PO.05) on the increase of sugar release (76.97%), soluble glucose (21.27%) and soluble protein (37.7%). It is concluded that sheep rumen fluid enzyme has a great potential for improving nutritional quality of leucaena leaf meal of fish feed.
KEMAMPUAN LEMNA (LEMNA PERPUSILLA TORR.) SEBAGAI FITOREMEDIATOR UNTUK MENYERAP LIMBAH NITROGEN DALAM BUDIDAYA IKAN LELE (CLARIAS GARIEPINUS) DI SISTEM RESIRKULASI Amalia, Febrina; Nirmala, Kukuh; Harris, Enang; Widiyanto, Tri
LIMNOTEK - Perairan Darat Tropis di Indonesia Vol 21, No 2 (2014)
Publisher : Research Center for Limnology

Show Abstract | Download Original | Original Source | Check in Google Scholar

Abstract

Penelitian ini bertujuan untuk mengkaji kemampuan lemna (Lemna perpusilla Torr.) sebagai fitoremediator dalam menyerap limbah nitrogen dalam budidaya ikan lele (Clarias gariepinus). Rancangan percobaan yang digunakan adalah rancangan acak lengkap (RAL) dengan 3 ulangan. Perlakuan berupa luas tutupan lemna sebesar 14,7%, 29,4%, dan 44,1% dari kolam filter. Padat tebar ikan lele adalah 200 ekor m-3 dengan bobot rata-rata awal 9,67±1,01 g. Hasil penelitian setelah 30 hari menunjukkan bahwa perlakuan luas tutupan lemna 44,1% dapat menyerap limbah N sebesar 4,48±0,04 g N, sedangkan untuk perlakuan luas tutupan lemna 29,4% dan 14,7% dapat menyerap limbah N masing-masing sebesar 4,03±0,02 g N dan 3,50±0,07 g N. Jumlah N dalam biomassa lemna tertinggi juga dicapai oleh perlakuan luas tutupan lemna 44,1% sebesar 28,13±0,74 g N. Sintasan tertinggi 76,33±4,04% juga diperoleh pada perlakuan luas tutupan 44,1%.
PEMANFAATAN Lemna perpusilla SEBAGAI PAKAN KOMBINASI UNTUK IKAN NILA (Oreochromis niloticus) PADA SISTEM RESIRKULASI Ilyas, Anita Prihatini; Nirmala, Kukuh; Harris, Enang; Widiyanto, Tri
LIMNOTEK - Perairan Darat Tropis di Indonesia Vol 21, No 2 (2014)
Publisher : Research Center for Limnology

Show Abstract | Download Original | Original Source | Check in Google Scholar

Abstract

Lemna perpusilla adalah suatu makrofit yang hidup terapung di air, terdapat di seluruh dunia dan banyak ditemukan di air tawar yang kaya nutrien. Tumbuhan ini lebih dikenal sebagai gulma yang cenderung sulit untuk dikendalikan karena memiliki produktivitas yang sangat tinggi. Penelitian untuk menganalisis kemampuan ikan nila (Oreochromis niloticus) dalam memanfaatkan L. perpusilla sebagai pakan kombinasi telah dilakukan. Rancangan percobaan yang digunakan adalah rancangan acak lengkap (RAL) dengan empat taraf perlakuan dan tiga ulangan. Perlakuan konsentrasi pakan 100% L. perpusilla + 0% pelet, 25% L. perpusilla + 75% pelet, 50% L. perpusilla + 50% pelet, 0% L. perpusilla + 100% pelet. Ikan yang digunakan dalam penelitian ini adalah ikan nila (O. niloticus). Padat tebar ikan 20 individu per waring dengan bobot rata-rata 20±0,01 g per individu. Ikan diberi pakan sebanyak dua kali per hari selama 50 hari. Setiap tujuh hari sekali dilakukan penimbangan bobot tubuh ikan nila. Hasil penelitian menunjukkan bahwa L. perpusilla dapat menggantikan pelet sebagai pakan sebesar 25%. Lemna tidak dapat menggantikan pakan secara keseluruhan karena terkait dengan tingginya serat yang terkandung di dalamnya yang dapat mempersingkat waktu tubuh untuk melakukan proses pencernaan dan penyerapan nutrisi.
Molecular identification of pathogenic bacteria and PCR specific primer design Aris, Muh.; Sukenda, Sukenda; Harris, Enang; Sukadi, Muh. Fatuhcri
e-Journal BUDIDAYA PERAIRAN Vol 1, No 3 (2013)
Publisher : Universitas Sam Ratulangi

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.35800/bdp.1.3.2013.2733

Abstract

Management of healthy seaweed aquaculture and control of ice ice disease are important component in seaweed production. To support the integrated prevention of ice ice disease, information about genetic variation of bacterial pathogen and the availability of fast and accurate detection are required. This study aimed to identify bacterial pathogen based on gene sequence analysis 16S-rRNA, construction of specific PCR primer from gene sequent analysis 16S-rRNA from bacteria that had the highest pathogenicity. Gene 16S rRNA of bacteria that had the highest pathogenicity was amplificated with universal primer PCR domain forward primer 63f (5’-CAG GCC TAA CAC ATG CAA GTC-3’) and reverse primer 1387r (5’-GGG CGG WGT GTA CAA GGC-3’). DNA Sequence obtained was compared to data base European Bioinformatics Institute (EBI) BLASTN. Construction and feasibility analysis of primer pair was done using primer 3 program. Two specific primer PCR were successfully constructed namely aSEFM-F (5- CAGCCACACTGGAACTGAGA-3) and aSEFM-R(5 TTAGCCGGTGCTTCTTCTGT -3). Both primer reacted optimum at 60°C and produced 201 bp amplicon. Keywords: pathogenicity, gene 16S-rRNA, PCR, primer, specific
Toksisitas Produk Ekstrasellular (ECP) Streptococcus agalactiae pada Ikan Nila (Oreochromis niloticus) Hardi, Esti Handayani; Sukenda, Sukenda; Harris, Enang; Lusiastuti, Angela Mariana
Jurnal Natur Indonesia Vol 13, No 3 (2011)
Publisher : Lembaga Penelitian dan Pengabdian kepada Masyarakat Universitas Riau

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (919.679 KB) | DOI: 10.31258/jnat.13.3.187-199

Abstract

This research aimed to know the toxicity of extracellular products (ECP) of Streptococcus agalactiae was tastedin cultured Nile tilapia (Oreochromis niloticus). Streptococcus agalactiae had two haemolytic types: β-haemolyticand non-haemolytic type. Toxicity test of ECP to know the virulancy factor of S. agalactiae was still limited. It wasfound that after tested on 15 fish weighing 15 g through intraperitoneal injection 0,1 ml/fish, both bacteria causedchanges in swimming pattern, palatability, external and internal anatomy macroscopically and microscopically.Extracellular products of S. agalactiae non-haemolytic type (BHIA and BHI 24 h) and β-haemolytic type (BHI 72 h)caused mortality 12 hours after injection and the mortality continued till day 7 th of culture. Whirling happened 96hours after injection with ECP S. agalactiae β-haemolytic type (BHIA 72 h incubation) whereas injection with ECP(BHI 24 h) on 72 h after injection and continued untill day 7 th. Behavior disease signs caused by S. agalactiaeoccured on eyes. There were opacity, purulens, eye shrink, lateral and bilateral exopthalmia and haemorrhage oninfected-fish. Silver staining of sodium dodecyl sulphate-polyacrylamide gels to S. agalactiae revealed thatpredominant 51.8-69.6 kDa bands were present in BHIA ECP fraction. The 69.6 kDa was absent from the BHI ECP.Total protein on non-haemolytic S. agalactiae ECP are 28.18 ppm on BHIA medium and 13.64 ppm on BHI medium.Whereas β-haemolytic S. agalactiae ECP are 2.73 ppm on BHIA medium and 8.18 ppm on BHI medium. Concentrationof protein in ECP was one of factor that caused non-haemolytic S. agalactiae more virulent than β-haemolytic type.The conclusion from the research that ECP was virulent factor on β-haemolytic and non-haemolytic S. agalactiaein fish which caused changes in behavior disease signs.
Co-Authors A.A. Ketut Agung Cahyawan W ANGELA MARIANA LUSIASTUTI Esti Handayani Hardi Febrina Amalia Ilyas, Anita Prihatini Ing Mokoginta Kukuh Nirmala Muh. Aris Muh. Fatuhcri Sukadi Sukenda Sukenda Tri Widiyanto