Article Per Year (5 Year)
p-Index From 2019 - 2024
0.23
P-Index
This Author published in this journals
All Journal JSFK (Jurnal Sains Farmasi & Klinis) Jurnal Ilmiah Ibnu Sina (JIIS): Ilmu Farmasi dan Kesehatan
Maria Martina Sulastri
Sekolah Tinggi Farmasi Bandung
Biochemistry, Genetics & Molecular Biology Health Professions Immunology & microbiology Medicine & Pharmacology Public Health

Published : 2 Documents Claim Missing Document
Claim Missing Document
Check
Articles

Found 2 Documents
Search

 1 
DETEKSI CEPAT GEN INVA PADA SALMONELLA ATCC DENGAN LOOP-MEDIATED ISOTHERMAL AMPLIFICATION (LAMP) Soni Muhsinin; Rahma Ziska; Maria Martina Sulastri
Jurnal Ilmiah Ibnu Sina (JIIS): Ilmu Farmasi dan Kesehatan Vol 4 No 1 (2019): JIIS
Publisher : Sekolah Tinggi Ilmu Kesehatan ISFI Banjarmasin

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (238.078 KB) | DOI: 10.36387/jiis.v4i1.264

Abstract

Salmonella spp. is a bacterium that causes typhoid salmonellosis (typhoid fever). These bacteria enter through the oral route, usually by contaminating food and drinks. Salmonella spp. has an invA gene that causes pathogenicity in humans. The culture method is used as a gold standard to detect Salmonella spp. However, this method requires infrastructure and is laborious. The purpose of this study is to develop detection of Salmonella spp. using the Loop-Mediated Isothermal Amplification (LAMP) method. The stages of the study began with the primary design of LAMP, Salmonella ATCC culture, DNA Isolation of Salmonella ATCC culture, and Salmonella ATCC LAMP Optimization. Primary LAMP that has been designed consists of three pairs. Salmonella ATCC DNA that has been isolated has a concentration of 4,5 ng/ul. The LAMP method shows positive results in detecting the InvA gene in Salmonella ATCC. Positive results are indicated by fluorescence in Salmonella ATCC DNA samples, whereas the negative results are shown in the absence of fluorescence in nuclease free water. The conclusion from the research that has been done, LAMP method can detect InvA gene in Salmonella ATCC.
Deteksi Cepat Gen InvA pada Salmonella spp. Dengan Metode PCR Soni Muhsinin; Maria Martina Sulastri; Dadih Supriadi
Jurnal Sains Farmasi & Klinis Vol 5, No 3 (2018): J Sains Farm Klin 5(3), Desember 2018
Publisher : Fakultas Farmasi Universitas Andalas

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (1065.944 KB) | DOI: 10.25077/jsfk.5.3.191-200.2018

Abstract

Salmonella spp. merupakan penyebab infeksi utama pada manusia melalui rute oral dengan cara mengkontaminasi makanan dan minuman. Penyakit yang disebabkan oleh Salmonella spp. disebut salmonellosis. Salmonella spp. memiliki gen invA yang menyebabkan patogen pada manusia. Deteksi gen InvA dapat dilakukan dengan metode PCR. Tujuan penelitian ini adalah untuk pengembangan metode deteksi cepat Gen InvA pada Salmonella spp. dengan metode PCR. Tahapan metode penelitian dimulai dari kultur Salmonella ATCC, Isolasi DNA Salmonella ATCC, Analisis Kuantitatif DNA Salmonella ATCC, Desain primer spesifik untuk deteksi gen InvA, Karakterisasi primer, Optimasi komponen PCR. Hasil isolasi DNA Salmonella ATCC yang didapat dengan konsentrasi DNA sebesar 4,5 ng/ul dengan kemurnian DNA 1,66. Primer PCR yang telah didesain untuk deteksi gen InvA terdiri dari satu pasang primer, yaitu InvA-F: 5’ TCGTCATTCCATTACCTACC 3’dan InvA-R: 5’ AAACGTTGAAAAACTGAGGA 3’ yang menghasilkan produk PCR gen InvA sepanjang 119 bp. Gen InvA dapat dideteksi dengan cepat menggunakan metode PCR yang telah dioptimasi komponen PCR.
Co-Authors Dadih Supriadi Rahma Ziska Soni Muhsinin