Garuda - Garba Rujukan Digital

p-Index From 2019 - 2024

0.408

P-Index

This Author published in this journals

All Journal Jurnal Ilmu Pertanian Indonesia Jurnal Akuakultur Indonesia Jurnal Veteriner e-Journal BUDIDAYA PERAIRAN Jurnal Natur Indonesia Jurnal Pengelolaan Sumberdaya Alam dan Lingkungan (Journal of Natural Resources and Environmental Management) Omni-Akuatika JITTER (Jurnal Ilmiah Teknologi Informasi Terapan) JUMLAHKU: Jurnal Matematika Ilmiah STKIP Muhammadiyah Kuningan Jurnal Sains Terapan : Wahana Informasi dan Alih Teknologi Pertanian

Sukenda Sukenda

Departemen Budidaya Perairan, Fakultas Perikanan Dan Ilmu Kelautan, Institut Pertanian Bogor Kampus IPB Darmaga Bogor 16680

Author-ID : 390256

Agriculture, Biological Sciences & Forestry Biochemistry, Genetics & Molecular Biology Chemical Engineering, Chemistry & Bioengineering Chemistry Civil Engineering, Building, Construction & Architecture Computer Science & IT Control & Systems Engineering Earth & Planetary Sciences Economics, Econometrics & Finance Education Electrical & Electronics Engineering Engineering Environmental Science Industrial & Manufacturing Engineering Mathematics Mechanical Engineering Social Sciences Veterinary

Published : 20 Documents Claim Missing Document

Claim Missing Document

Articles

1 2

The Chemical Composition of Gracilaria verrucosa Extract and its Utilization on Survival and Growth Litopenaeus vannamei Jasmanindar, Yudiana; Sukenda, Sukenda; Alimuddin, Alimuddin; Junior, Muhammad Zairin; Utomo, Nur Bambang Priyo
Journal Omni-Akuatika Vol 14, No 3 (2018): Omni-Akuatika November
Publisher : Fisheries and Marine Science Faculty - Jenderal Soedirman University

The Gracilaria genus is a potential source of natural and environmentally-friendly alternatives in improving the survival and growth of shrimp. This study aims to identification immunostimulant molecules extract G. verrucosa and evaluate the utilization of G verrucosa extract as an immunostimulant in improving survival and growth of L. vannamei. Seaweed extraction used ethyl acetate then formulated in the diets. The immunostimulant molecule in the G. verrucosa was analysis. The shrimp were fed a test diet containing extract G. verrucosa at a dose of 2 g kg-1 or extract G. verrucosa-free control diets for 42 days. Shrimps were fed diets containing extract with a specific duration. The observation on the survival and growth of L. vannamei was performed after maintenance at the Laboratory for six weeks. Following, diets containing extract was tested in the field (pond shrimp farm) at the same dose of extract for 58 days. Shrimp was feed diets containing extract once a week, once in the early culture, and diet control, then the survival and growth shrimp were analysis. Concentrations of sulfates and carbohydrates in G. verrucosa ethyl acetate-extract were 24.21% and 13.41%, and crude protein 3.64%. GC-MS pyrolysis results show that G. verrucosa polysaccharide is similar to immunostimulant molecules. The survival shrimp gave diets containing G. verrucosa extract formulation was higher than that of shrimps fed controls diet. The Shrimp fed diets extracts have higher growth than shrimp given control dietsKeywords: Gracilaria, extract, polysaccharides, immunostimulant

Molecular identification of pathogenic bacteria and PCR specific primer design Aris, Muh.; Sukenda, Sukenda; Harris, Enang; Sukadi, Muh. Fatuhcri
e-Journal BUDIDAYA PERAIRAN Vol 1, No 3 (2013)
Publisher : Universitas Sam Ratulangi

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.35800/bdp.1.3.2013.2733

Management of healthy seaweed aquaculture and control of ice ice disease are important component in seaweed production. To support the integrated prevention of ice ice disease, information about genetic variation of bacterial pathogen and the availability of fast and accurate detection are required. This study aimed to identify bacterial pathogen based on gene sequence analysis 16S-rRNA, construction of specific PCR primer from gene sequent analysis 16S-rRNA from bacteria that had the highest pathogenicity. Gene 16S rRNA of bacteria that had the highest pathogenicity was amplificated with universal primer PCR domain forward primer 63f (5â€™-CAG GCC TAA CAC ATG CAA GTC-3â€™) and reverse primer 1387r (5â€™-GGG CGG WGT GTA CAA GGC-3â€™). DNA Sequence obtained was compared to data base European Bioinformatics Institute (EBI) BLASTN. Construction and feasibility analysis of primer pair was done using primer 3 program. Two specific primer PCR were successfully constructed namely aSEFM-F (5- CAGCCACACTGGAACTGAGA-3) and aSEFM-R(5 TTAGCCGGTGCTTCTTCTGT -3). Both primer reacted optimum at 60Â°C and produced 201 bp amplicon. Keywords: pathogenicity, gene 16S-rRNA, PCR, primer, specific

Toksisitas Produk Ekstrasellular (ECP) Streptococcus agalactiae pada Ikan Nila (Oreochromis niloticus) Hardi, Esti Handayani; Sukenda, Sukenda; Harris, Enang; Lusiastuti, Angela Mariana
Jurnal Natur Indonesia Vol 13, No 3 (2011)
Publisher : Lembaga Penelitian dan Pengabdian kepada Masyarakat Universitas Riau

This research aimed to know the toxicity of extracellular products (ECP) of Streptococcus agalactiae was tastedin cultured Nile tilapia (Oreochromis niloticus). Streptococcus agalactiae had two haemolytic types: β-haemolyticand non-haemolytic type. Toxicity test of ECP to know the virulancy factor of S. agalactiae was still limited. It wasfound that after tested on 15 fish weighing 15 g through intraperitoneal injection 0,1 ml/fish, both bacteria causedchanges in swimming pattern, palatability, external and internal anatomy macroscopically and microscopically.Extracellular products of S. agalactiae non-haemolytic type (BHIA and BHI 24 h) and β-haemolytic type (BHI 72 h)caused mortality 12 hours after injection and the mortality continued till day 7 th of culture. Whirling happened 96hours after injection with ECP S. agalactiae β-haemolytic type (BHIA 72 h incubation) whereas injection with ECP(BHI 24 h) on 72 h after injection and continued untill day 7 th. Behavior disease signs caused by S. agalactiaeoccured on eyes. There were opacity, purulens, eye shrink, lateral and bilateral exopthalmia and haemorrhage oninfected-fish. Silver staining of sodium dodecyl sulphate-polyacrylamide gels to S. agalactiae revealed thatpredominant 51.8-69.6 kDa bands were present in BHIA ECP fraction. The 69.6 kDa was absent from the BHI ECP.Total protein on non-haemolytic S. agalactiae ECP are 28.18 ppm on BHIA medium and 13.64 ppm on BHI medium.Whereas β-haemolytic S. agalactiae ECP are 2.73 ppm on BHIA medium and 8.18 ppm on BHI medium. Concentrationof protein in ECP was one of factor that caused non-haemolytic S. agalactiae more virulent than β-haemolytic type.The conclusion from the research that ECP was virulent factor on β-haemolytic and non-haemolytic S. agalactiaein fish which caused changes in behavior disease signs.

Construction of a DNA Vaccine Using Glycoprotein Gene and Its Expression Towards Increasing Survival Rate of KHV-Infected Common Carp (Cyprinus carpio) Nuryati, Sri; Alimuddin, Alimuddin; Sukenda, Sukenda; Soejoedono, Retno Damayanti; Santika, Ayi; Pasaribu, Fachriyan Hasmi; Sumantadinata, Komar
Jurnal Natur Indonesia Vol 13, No 1 (2010)
Publisher : Lembaga Penelitian dan Pengabdian kepada Masyarakat Universitas Riau

Deoxyribonucleic acid (DNA) vaccine has recently been developed as an alternative vaccine against virus infection.This study was the first step of DNA vaccine development to protect cyprinids including common carp (Cyprinuscarpio) and fancy koi (Cyprinus carpio) from KHV (koi herpesvirus) infection in Indonesia. One of KHV glycoproteingenes, i.e. glycoprotein (GP) was ligated with Japanese medaka (Oryzias latipes) â-actin promoter to generatepAct/GP as a DNA vaccine. Fourty fish in body weight of 10-15 g/fish were individually injected by pAct/GP intomuscle in different dosage of 2.5 μg, 7.5 μg and 12.5 μg/100 μl phosphate buffer saline. Total RNA was extractedfrom the 12.5 μg of pAct/GP-injected fish muscle at 24, 48 and 67 hours post-injection to analyze GP expression byRT-PCR method. Potential of pAct/GP as DNA vaccine was examined by injecting KHV into the 30-days-vaccinatedfish. Both of possitive and negative control fish group were not vaccinated. Possitive control fish group wereinjected with KHV, but negative control fish group were not. KHV-challenged fish were reared for 1 month, and thedeath fish were calculated daily. Result of RT-PCR analysis showed that GP gene expression were detected at 3 dpost-injection. Expression of GP in the vaccinated fish groups helped to improve their survival rate after challengedby KHV. All of fish without DNA vaccination had dead 17 days after KHV injection. The results demonstrated thatpAct/GP had high potency to be used as a DNA vaccine against KHV infection in cyprinids.

Strategi Penerapan Ecosystem Approach To Aquaculture (EAA) Komoditas Udang di Kabupaten Pinrang Sulawesi Selatan eddy supriyono; Wisriati Lasima; Muhammad Zairin Junior; Sugeng Budiharsono; Kukuh Nirmala; Sukenda
Jurnal Pengelolaan Sumberdaya Alam dan Lingkungan (Journal of Natural Resources and Environmental Management) Vol. 11 No. 3 (2021): Jurnal Pengelolaan Sumberdaya Alam dan Lingkungan (JPSL)
Publisher : Graduate School Bogor Agricultural University (SPs IPB)

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.29244/jpsl.11.3.504-512

This study aims to develop a strategy for the sustainability of shrimp aquaculture using an ecosystem approach or EAA in Pinrang Regency, South Sulawesi. A series of analyzes were carried out, namely the environmental carrying capacity analysis of aquaculture using pond environmental feasibility standards, analysis of critical factors for the sustainability of aquaculture using multidimensional scaling analysis, analysis of the sustainability status of aquaculture using pairwise comparison analysis and analysis of shrimp aquaculture management strategies based on EAA. using hierarchy process analysis. The results showed that the following strategies were needed: a) accelerating spatial planning and implementing programs in accordance with the directions for spatial use and control; b) institutional strengthening of capital cultivators in order to complement and improve facilities and infrastructure in accordance with the SOP; and c) increasing the level of education and providing a social and economic security system for members of the shrimp farming community

Bakteri Probiotik Dalam Budidaya Udang: Seleksi, Mekanisme Aksi, Karakterisasi, dan Aplikasinya Sebagai Agen Biokontrol Widanarni Widanarni; Sukenda Sukenda; Mia Setiawati
Jurnal Ilmu Pertanian Indonesia Vol. 13 No. 2 (2008): Jurnal Ilmu Pertanian Indonesia
Publisher : Institut Pertanian Bogor

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (348.509 KB)

Bacterial disease attack occurs at the hatchery stage, which is considered to be the most serious threat, and often results in mass mortality of shrimp larvae by vibrosis which is that caused by a luminous bacterium identified as Vibrio harveyi. This research was carried out to obtain local isolates of probiotic bacteria that were able to inhibit the growth of V. harveyi and effectively apply it as a biocontrol of vibriosis in shrimp cultures. The research was carried out as follows: (1) In vitro and in vivo selection of probiotic bacteria candidates, (2) Study of the action mechanism and characterization of the selected pro biotic bacteria, (3) Study on application of the selected probiotic bacteria as a biocontrol agent in shrimp cultures. Results of in vitro and in vivo selection provided the best three isolates, which were 1Ub, SKT-b and Ua. The survival rate of shrimp larvae which were not only inoculated by V. harveyi but also with 1Ub, SKT-b and Ua probiotic bacteria were 88.33, 83.33, and 81.67% respectively; where as the positive control treatment (merely inoculated with V. harveyi) gave a 41.67% survival rate and the negative control (without bacterial addition) was 68.33%. Studies using a rifampicin resistant marker (RfR) demonstrated that the number of V. harveyi MR5339 RfR cells in treatments without probiotic addition were higher than the treatment with the probiotic bacteria, in dead larvae, living larvae, as well as in the culture media. Partial sequencing of the I6S-rRNA gene showed that the I Ub isolate was similar to Pseudoalteromonas piscicida, whereas the SKT -b and Ua isolates were similar to Vibrio alginolyticus. Selected probiotic bacteria could be applied directly to shrimp larva culture media, or orally through enrichment of both natural and artificial food. Keywords: Penaeus monodon larvae, probiotic bacteria, vibriosis

Screening of Probiotic Bacteria from Intestine and Culture Environment of Hoeven’s slender carp Leptobarbus hoeveni Blkr to Control Pathogenic Bacteria . Sunarto; . Sukenda; . Widanarni
Jurnal Akuakultur Indonesia Vol. 9 No. 2 (2010): Jurnal Akuakultur Indonesia
Publisher : Indonesian Society of Scientific Aquaculture (ISSA)

The ability of probiotic bacteria to control disease infection has been used in aquaculture. This experiment was conducted to isolate and characterize probiotic bacteria; the competition test its ability probiotic bacteria against pathogenic bacteria; and to improve survival rate of Leptobarbus hoeveni. The bacteria were isolated from Leptobarbus hoeveni and its culture environment, and then tested to know its ability to inhibit bacterial fish pathogen in-vitro. Furthermore, the selected probiotic bacteria were tested in vivo to evaluate their ability to inhibit pathogen of Leptobarbus hoeveni. The result showed that probiotic bacteria inhibit the growth of Streptococcus iniae, Flexibacter columnaris, Mycobacterium fortuitum and Aeromonas hydrophila in vitro. Isolate DD3 was the best of candidate probiotic because of the ability to inhibit pathogen, especially A. hydrophila, the most virulent bacteria in Leptobarbus hoeveni.Key Words : probiotic bacteria, Leptobarbus hoeveni, pathogenic bacteriaAbstrakKemampuan bakteri probiotik untuk mengendalikan penyakit infeksi telah digunakan dalam akuakultur. Tujuan penelitian ini adalah mengisolasi dan mengkarakterisasi bakteri probiotik, menguji kemampuan bakteri probiotik terhadap bakteri patogen, sehingga dapat meningkatkan tingkat kelangsungan hidup ikan jelawat. Bakteri diisolasi dari usus ikan jelawat dan lingkungan budaya, kemudian diuji kemampuannya menghambat bakteri patogen secara in-vitro. Selanjutnya bakteri probiotik yang dipilih diuji secara in vivo untuk mengevaluasi kemampuannya dalam menghambat patogen di dalam tubuh ikan jelawat. Dari hasil penelitian diperoleh bakteri probiotik yang diisolasi dari usus dan lingkungan budaya ikan jelawat menunjukkan penghambatan pertumbuhan terhadap Streptococcus iniae, Flexibacter columnaris, Mycobacterium fortuitum dan Aeromonas hydrophila secara in vitro. Isolat DD3 merupakan kandidat probiotik terbaik, karena mempunyai kemampuan untuk menghambat bakteri patogen, khususnya bakteri A. hydrophila adalah bakteri yang paling viluren bagi ikan jelawat. Kata Kunci: bakteri probiotik, ikan jalawat dan baktri patogen

Isolation and characterization of pathogenic Vibrio on tiger grouper Epinephelus fuscoguttatus . Ilmiah; . Sukenda; . Widanarni; Enang Harris
Jurnal Akuakultur Indonesia Vol. 11 No. 1 (2012): Jurnal Akuakultur Indonesia
Publisher : Indonesian Society of Scientific Aquaculture (ISSA)

This study was aimed to obtain pathogenic bacterial isolate causing vibriosis disease. Isolation of Vibrio was conducted from maribound tiger grouper collected from floating net cage in Barru Regency using TCBS medium. Ability to cause vibriosis was confirmed by pathogenicity test performed by mean injecting the tiger grouper juveniles with bacterial suspension at concentration of 106 CFU/fish and mortality of fish during seven days observation then was noted. Then, the Vibrio pathogenic isolate was characterized and identified based on morphology, growth, and biochemical features. Moreover, the most pathogenic isolate was identified by molecular analysis of 16S-rRNA gene sequences. The results showed that three potential isolates caused Vibriosis disease in tiger grouper culture. The isolates tested were biochemically identified as Vibrio metschnikovii, V. parahaemolyticus, and V. mimicus. The most virulent among isolates was V. parahaemolyticus. Keywords: isolation, characterization, pathogenic, vibriosis, tiger grouper

Selection of probiotic bacteria from the coral reef and tiger grouper fish (Epinephelus foscoguttatus) farming environment . Ilmiah; . Sukenda; . Widanarni; Enang Harris
Jurnal Akuakultur Indonesia Vol. 11 No. 2 (2012): Jurnal Akuakultur Indonesia
Publisher : Indonesian Society of Scientific Aquaculture (ISSA)

The use of probiotic bacteria is one of the methods in aquaculture to control infectious diseases. This study aims to obtain candidates probiotic bacteria from the coral reef and tiger grouper aquaculture environment (Epinephelus fuscoguttatus). Steps of the study included of: 1) isolation of candidates probiotic bacteria, 2) selection of candidates probiotic bacteria: inhibition test and co-culture methods, 3) enzymatic test, 4) the growth of bacteria test 5) pathogenicity test and 6) the molecular identification of probiotic bacteria. The results showed that of 124 isolates in test zone of inhibition, the four isolates with the widest zone of inhibition of isolate K7, K8, K21, and T4, a total of 51 isolates on co-culture methods, the four isolates were able to suppress the growth of pathogenic Vibrio bacteria, isolates K15, K68, K55, and T36. The results of hydrolyzing the highest protease amylase and lipase enzyme, respectively isolates K15 and T36; isolates T41 and K8; isolates K55 and K68. Candidates probiotic bacteria reached the exponential phase at 16‒18 h. The results of pathogenicity test isolate K7, K8, T36, and T41 provided the highest survival that can be used as candidates probiotics in the tiger grouper. Keywords: selection, probiotics, tiger grouper

Protein digestibility and ammonia excretion in catfish Clarias gariepinus culture Bambang Gunadi; Enang Harris; Eddy Supriyono; . Sukenda; Tatag Budiardi
Jurnal Akuakultur Indonesia Vol. 12 No. 1 (2013): Jurnal Akuakultur Indonesia
Publisher : Indonesian Society of Scientific Aquaculture (ISSA)

ABSTRACT A series of experiments was performed to analyze protein digestibility, ammonia excretion, and also heterothropic bacteria and phytoplankton dynamics in the catfish Clarias gariepinus culture. In the digestibility experiment, catfish with an individual initial size of 43.67±0.83 g were stocked into 120 L conical fiberglass tanks at a density of 20 fish per tank. Fish were fed on with commercial diet supplemented with Cr2O3 indicator at a concentration of 1%. In the ammonia excretion experiment, catfish with an individual size of 111.6±9.5 and 40.6±3.4 g, respectively, were placed into a 10 L chamber filled with 8 L of water. Total ammonia nitrogen (TAN) in the chambers were monitored every hour for six consecutive hours. In the bacteria and phytoplankton dynamics experiment, catfish were stocked in the 25 m2 concrete tanks which was divided into two compartments (catfish 10 m2, and heterotrof compartments 15 m2). Catfish with individual size of 42,5±0 g were stocked into the tanks at a density of 100 fish per tank. Water was recirculated from catfish compartments to heterotrophic compartments. Fish were fed with floating feed. Molasses as carbon source for heterotrophic bacteria was applied daily. The experiment was conducted for six weeks. The results showed that the protein digestibility was 61.97±7.24%. Larger fish (size of 111.6 g) excreted ammonia at a rate of 0.008±0.003 mg TAN/g fish-weight/hour, which was lower than that of the smaller catfish (size of 40.6 g), i.e. 0.012±0.004 mg TAN/g fish-weight/hour. Keywords: protein digestibility, ammonia excretion, catfish ABSTRAK Serangkaian penelitian telah dilakukan untuk menganalisis ketercernaan pakan dan protein, ekskresi amonia, serta dinamika bakteri dan fitoplankton pada budidaya ikan lele (Clarias gariepinus). Pada penelitian ketercernaan pakan, ikan lele berukuran 43,67±0,83 g/ekor dipelihara dalam bak fiberglas berbentuk corong berukuran 120 L dengan kepadatan 20 ekor/bak. Ikan diberi pakan berupa pelet yang diberi indikator Cr2O3 sebanyak 1%. Pada penelitian ekskresi amonia, ikan lele berukuran 111,6±9,5 dan 40,6±3,4 g/ekor yang telah diberi makan sampai kenyang dimasukkan ke dalam stoples berisi 8 L air. Kadar amonia total (total ammonia nitrogen, TAN) di dalam stoples diukur setiap jam selama enam jam. Pada penelitian dinamika bakteri dan fitoplankton, ikan lele dipelihara pada bak beton berukuran 25 m2 yang disekat menjadi dua bagian yaitu bagian ikan lele (10 m2) dan bagian heterotrof (15 m2). Ikan lele dengan bobot awal 42,5 g/ekor ditebar ke dalam bak dengan kepadatan 100 ekor/bak. Air mengalir secara resirkulasi dari bagian ikan lele ke bagian heterotrofik dengan bantuan pompa. Pakan yang diberikan berupa pelet apung komersial. Molase ditambahkan setiap hari sebagai sumber karbon untuk pertumbuhan bakteri heterotrofik. Penelitian dilaksanakan selama enam minggu. Hasil pengamatan menunjukkan bahwa ketercernaan protein dari pakan yang diuji adalah 61,97±7,24%. Ikan lele berukuran besar (111,6 g/ekor) menghasilkan amonia sebanyak 0,008±0,003 mg TAN/g ikan/jam, lebih rendah dibandingkan dengan ikan yang berukuran lebih kecil (40,6 g/ekor), yaitu 0,012±0,004 mg TAN/g ikan/jam. Kata kunci: ketercernaan protein, ekskresi amonia, ikan lele

Co-Authors . Sunarto Alimuddin Alimuddin Alit Brilliant ANGELA MARIANA LUSIASTUTI Angela Mariana Lusiastuti Ari Purno Wahyu Ayi Santika Bambang Gunadi Benny Yustim Dian Febriani Dinamella Wahjuningrum Dwi Agung Saputra Eddy Supriyono Enang Harris Enang Harris Enang Harris Enang Harris Enang Harris Esti Handayani Hardi Evan Farhan Wahyu Puadi Fachriyan Hasmi Pasaribu Ilmiah Ilmiah Jasmanindar, Yudiana Jeanni Indah Noermala Khairun Nissa Komar Sumantadinata Kukuh Nirmala M. Zairin Junior Mia Setiawati Muh. Aris Muh. Fatuhcri Sukadi Muharram Nur Ikhsan Nur Bambang Priyo Utomo Retno Damayanti Soejoedono Sri Nuryati Sri Nuryati Sugeng Budiharsono Sunjana Sunjana Tatag Budiardi Trian Rizky Febriansyah Umbara, Uba Widanarni Widanarni Wisriati Lasima Yan Evan Yan Puspitarani

Title

Found 20 Documents
Search

Abstract

Abstract

Abstract

Abstract

Abstract

Abstract

Abstract

Abstract

Abstract

Abstract

Title Search

Found 20 Documents Search

Abstract

Abstract

Abstract

Abstract

Abstract

Abstract

Abstract

Abstract

Abstract

Abstract

Title

Found 20 Documents
Search