cover
Contact Name
Widodo
Contact Email
nst.journal.editor@gmail.com
Phone
+6282132116373
Journal Mail Official
nst.journal.editor@gmail.com
Editorial Address
Jalan Akasia Permai A.10, Malang, Jawa Timur, Indonesia
Location
Kab. malang,
Jawa timur
INDONESIA
Nusantara Science and Technology Proceedings
Published by Future Science
ISSN : -     EISSN : 26229692     DOI : -
NST Proceeding supports regional research communities to globalise their findings in Science and Technology by providing an open access, online platform in line with international publishing standards and indexing scholarly conference proceedings. The current emphasis of the NST Proceeding includes (but is not limited to) the following areas: Life Science, Mathematics, Eductation, Social Science, Medicinal Science and etc. All conference papers published on the NST Proceeding are fully Open Access. Open Access publications are freely and permanently available online to any reader, anywhere in the world without subscription to the publications in which these articles are published. Unrestricted use, distribution, and reproduction in any medium are permitted, provided the author/editor is properly attributed. NST Proceeding will provide high-quality peer review by scientific comittee and proofreading service by native speaker to make sure the language quality. We are the best in rapid publication processes for the open access content, maximum visibility and all-time availability for the published articles, citation tracking and indexing in a variety of databases.
Articles 7 Documents
Search results for , issue "2nd Bioinformatics and Biodiversity Conference" : 7 Documents clear
In Silico Analysis of Sox2 Gene for Pluripotency Detection at Mouse Embryonic Fibroblast and induced Pluripotent Stem Cell (iPSC) Aroem Naroeni; Seprianto; Kevin Febrianus Moda
Nusantara Science and Technology Proceedings 2nd Bioinformatics and Biodiversity Conference
Publisher : Future Science

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.11594/nstp.2022.2101

Abstract

Stem cells are cells that have not been specialized and have a specific characteristic compared to other cells. There are several transcription factors like Sox2, Oct4, c-Myc, and Nanog to maintain embryonic stem cells. In pluripotent stem cells, sex-determining region Y-box 2 (Sox2) is a critical transcriptional regulator, and for somatic cell reprogramming, which involves returning differentiated cells to a pluripotent embryonic state by reversing their epigenetic arrangement. This study aimed to design primers for detecting the Sox2 gene expressed in Mouse Embryonic Fibroblasts and induced Pluripotency Stem Cell as pluripotency detection in stem cell research. In silico analysis was carried out to detect ofx2gene by using several software such as BLAST to search sequence Sox2 gene from Homo sapiens and Mus musculus, Bioedit for sequence alignment, SnapGene for PCR in silico, and PrimerBlast for online primer design. Primer candidates successfully designed were then analyzed for their secondary structure using NetPrimer. The results showed that forward primer (5'- CTACAGCATGTCCTACTCGCA -3') and reverse primer (5'- ACTTGACCACAGAGCCCA -3') were selected primers for M. musculus. Also, forward primer (5’-CTACAGCATGTCCTACTCGCA-3') and reverse primer (5'- ACTT-GACCACCGAACCCA-3') for Homo sapiens. Detection by PCR in silico using templates from H. sapiens and M. musculus sequences showed that the primers could specifically amplify the Sox2 gene in each species. Nevertheless, laboratory experiments need to be carried out for preliminary validation that has been designed. These primers will be used to measure the gene expression of Sox2 in qRT-PCR to detect the stemness characteristic of stem cells.
Effect Soursop (Annona muricata L.) Leaf Aqueous Extract (SLAE) on Remodeling of Ventricle Heart Tissue in Obesity Rats Model Hafidh Nur Haq; Aris Rosidah; Dini Sri Damayanti
Nusantara Science and Technology Proceedings 2nd Bioinformatics and Biodiversity Conference
Publisher : Future Science

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.11594/nstp.2022.2102

Abstract

A high-fat and high-fructose diet can lead to obesity which contributes to an increased risk of heart failure complications. Soursop leaves are known to have the potential of antioxidant, but research about the effects of soursop leaf on complications of heart failure has never been studied. This study evaluated whether soursop leaf aqueous extract can inhibit the total of cardiomyocyte necrosis, cardiomyocyte diameter, and density of cardiac collagen in obese rats. The heart organs of obese rats that have been paraffin, which randomly divided into normal group, obesity group, and soursop leaf aqueous extract (SLAE) group with dose I (100 mg/kgbw), II (200 mg/kgbw), and III (400 mg/kgbw) (n=6 rats). The rats were induced by high-fat high-fructose and SLI diets for 10 weeks. The number of necrosis and diameter cardiomyocytes were measured by using Hematoxylin Eosin staining, while the density of cardiac collagen was measured by Masson's Trichrome staining and then observed with a trinocular and dot side microscope at 200x and 400x magnification. Statistical analysis using One Way ANOVA and continued by LSD test. We found that group SLAE with doses I, II, and III significantly reduced the number of cardiomyocyte necrosis and cardiac collagen density compared to the obesity group. The SLI group with doses II and III significantly reduced the diameter of cardiomyocytes compared to the obesity group, while the SLAE group with the dose I was unable to reduce the diameter of cardiomyocytes. In conclusion, Soursop leaf aqueous extract can inhibit the increase of cardiac collagen density, number necrosis and diameter cardiomyocyte.
Compounds Profile of Polar Subfraction of Ethyl Acetate Fraction of Soft Coral Nepthea sp., Antioxidant and Cytotoxic Properties Baru Sadarun; Adryan Fristiohady; Nur Syifa Rahmatika; Agung Wibawa Mahatva Yodha; Muhammad Hajrul Malaka; Andini Sundowo; I. Sahidin
Nusantara Science and Technology Proceedings 2nd Bioinformatics and Biodiversity Conference
Publisher : Future Science

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.11594/nstp.2022.2103

Abstract

Nepthea sp., a soft coral In Indonesia's South-East Sulawesi, it thrives. The chemical and pharmacological properties of this genus have not been studied in this location. As a result, the goal of this page is to offer a broad overview of both properties of Nepthea sp. The sample was taken from Hoga Island. Methanol was used to extract the material, which was then fractionated with hexane and ethyl acetate to produce n-hexane, ethyl acetate, and methanol fractions. Vacuum liquid chromatography was also used to fractionate the ethyl acetate fraction. Phytochemical screening, LC-MS/MS, Total Phenolics Content (TPC), and Total Flavonoids Content (TFC) were used to determine the chemical contents. DPPH radicals and ABTS were used to assess antioxidant activity and MTT assays for cytotoxicity. Six subfractions are produced by fractioning the ethyl acetate fraction (160 g), with the most polar subfraction (F) weighing 15.4 g. The phenolics and flavonoids constituents in Subfraction F have IC50 values of 68.77±4.8 mg GAE/g extract and 0.22±0.1 mgQE/g extract, respectively. The presence of phenolics, flavonoids, and alkaloids in the subfraction F is supported by the LC-MS/MS data, Subfraction F has 3-ter-butyl-4-methoxyphenol (terpenoids or phenolics compound), isosalsoline (alkaloids), valine (amin acid), and several unidentified chemicals with molecular formulas C15H23NO3, C33H47NO4, C29H49NO3 (alkaloids or amino acid) and C8H18O3 (phenolic compound).The IC50 values (mg/L) of 101.1 ± 8.8 (DPPH) and 89.76 ± 7.5 (ABTS) indicate that F has antioxidant capacity, and it is also cytotoxic against breast cancer cell lines (MCF-7) with an IC50 of 170.72±6.5mg/mL.
Utilization of Waste Frying Oil as A Source of Carbon in The Production of Biosurfactant using Exiguobacterium profundum Irma Mardiah; Kartika Puspitaningrum; Syarif Hamdani; Nur Asni Setiani
Nusantara Science and Technology Proceedings 2nd Bioinformatics and Biodiversity Conference
Publisher : Future Science

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.11594/nstp.2022.2104

Abstract

Biosurfactant is a secondary metabolite produced by microorganisms that can be used as an alternative to environmentally friendly surfactants. Exiguobacterium profundum is one of the biosurfactants producers that potentially to be used in the pharmaceutical field. The use of waste frying oil as a carbon source can be used as a solution in overcoming the high cost of producing biosurfactants. The purpose of this study was to obtain optimum conditions in the production of biosurfactants by utilizing waste frying oil as a carbon source. In this study, variations in the optimized production conditions included the concentration of waste frying oil, labeled 2%, 3%, 4%, and 5%, and the medium pH at 6, 7, and 8. The study was using Mineral Salt Medium as production medium, the amount of inoculum concentration was 10% v/v, agitation speed 160 rpm, and incubation at room temperature. The optimum conditions for biosurfactant production were determined based on the best emulsification index. The biosurfactant extraction was carried out using a combination of chloroform and methanol (2:1) solvents. The best concentrations of waste frying oil for Exiguobacterium profundum was 5%, and the best medium pH was 7. Biosurfactants produced from Exiguobacterium profundum amounted to 8,2 g/L with an emulsification index 63,2%.
Processing of Red Dahlia Tubers in Produce Inulin Extract and Material Proximate Testing Sunarti Sunarti; Chrismis Novalinda Ginting; Sahna Ferdinand Ginting
Nusantara Science and Technology Proceedings 2nd Bioinformatics and Biodiversity Conference
Publisher : Future Science

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.11594/nstp.2022.2105

Abstract

Dahlia tubers from Berastagi, North Sumatra, are plants that contain carbohydrates and contain high levels of inulin. Inulin is very good as a dietary fiber and has other physiological functions such as lowering blood sugar and blood fat, anticancer, regulating intestinal microbial flora, increasing absorption of minerals and vitamins. Currently, the utilization of dahlia tubers is not optimal in the community and is considered as agricultural waste, therefore it is necessary to manage dahlia tubers in producing inulin extract and study the proximate material, considering that previous studies still obtained varying results. This study aimed to obtain inulin extract and its yield value and to measure the proximate material of red dahlia tuber. The extraction method used is based on the solubility of inulin in water at a temperature of 800 C. And precipitation are carried out with 70% ethanol. Proximate examination of the material consisted of water content using the heating method, ash content using the gravimetric method, fat and crude fiber content using the Soxhlet method, determination of protein content using the Macro Kjedhal method, and carbohydrate content using the proximate method using the carbohydrate percentage formula. The results obtained were 48,25% Inulin Flour yield, the proximate results obtained 80,8% water content, 0,36% ash content, 0,33% total fat content, 1,29% crude fiber content, protein content 1,15%, Carbohydrate content 14.6%. From this study, it can be concluded that dahlia tubers contain high carbohydrates and low-fat content, have crude fiber and protein that can be used as low-calorie foodstuffs.
Typhonium flagelliforme as a Cancer Prevention Plant-Based on In Vitro, In Vivo and Bioinformatics Research Method: A Systematic Literature Review Teddy Siswanto; Ratna Shofiati; Ismi Hasnatul Afifah
Nusantara Science and Technology Proceedings 2nd Bioinformatics and Biodiversity Conference
Publisher : Future Science

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.11594/nstp.2022.2106

Abstract

The development of cancer-preventing plant research develops along with the development of science and information technology. The purpose of this study was to collect research related to the Typhonium flagelliforme plant so that it can be used to add to the research literature that synergizes with multi-scientific disciplines. This research method uses a Study Literature Review from the journals Proquest, ScienceDirect, NCBI, and other journals since 2012 with the keywords Typhonium flagelliforme or Rodent Tuber or Keladi-tikus to identify the type of research In Vitro, In Vivo and Bioinformatics and search by journal publisher category. The results of the Systematic Literature Review research obtained a total of 194 papers and after being traced from the abstract, then 51 papers were selected consisting of 42 In Vitro research papers, 1 In Vivo paper and 6 Bioinformatics papers, and a combination of In Vitro and In Vivo papers totaling 2 papers. Meanwhile, based on scientific fields the most are from Natural Science, Medicine, Bioinformatics, and Pharmacy. Based on the results of research identification, further research is proposed for Typhonium flagelliforme as a plant that has the potential to prevent cancer, can involve researchers from different scientific families so that it is suitable for multi-disciplinary research by synergizing the three methods of In Vitro, In Vivo and Bioinformatics through the involvement of researchers from Biology, Chemistry, Medicine, Pharmacy and Informatics to get further research depth.
In Silico Design and Validation of CRISPR-Cas13a System as a Potential Antiviral for SARS-CoV-2 in Indonesia Alfero Putra Iryanto; Christy; Muhammad Farrel Ewaldo; Anggia Prasetyoputri; Ratih Asmana Ningrum; Riza Arief Putranto; Akhirta Atikana
Nusantara Science and Technology Proceedings 2nd Bioinformatics and Biodiversity Conference
Publisher : Future Science

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.11594/nstp.2022.2107

Abstract

The novel severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) has caused a worldwide pandemic of coronavirus disease (COVID-19). Indonesia is one of the countries with large numbers of positive cases in Asia with certain dominant variants. Currently, there are no specific therapeutic agents against SARS-CoV-2. Therefore, the development of specific and effective therapeutic tools is urgently needed to overcome the pandemic. This study designed a CRISPR-Cas13a system strategy as a potential anti-SARS-CoV-2. We utilized comprehensive bioinformatics methods to identify a unique segment in the SARS-CoV-2 consensus sequence from Indonesia that is different from the related segment in the SARS-CoV. This unique segment was used as a specific target for SARS-CoV-2 Spike Protein to design a set of crRNA libraries. Off-target analysis and molecular docking simulation were performed to validate the specificity and to analyze interactions among the crRNA candidates, target RNA, and Cas13a. Our study identified a 17 amino acid unique segment on the Receptor Binding Domain (RBD) region. By using that unique segment, a total of 12 crRNA candidates were selected based on their GC content. Finally, based on the off-target and molecular docking validation, four crRNAs were selected as potential candidates for CRISPR-Cas13a-based antivirals. Although further validation with in vitro assays is important, the present study provides a comprehensive demonstration regarding the potential of CRISPR-Cas13a as a strategy for SARS-CoV-2 antiviral development. Considering the specific property of the CRISPR system, the present methodology can also be utilized to develop novel antiviral candidates for other RNA viruses.

Page 1 of 1 | Total Record : 7


Filter by Year

0000


Filter By Issues
All Issue The 3rd International Conference on Vocational Innovation and Applied Sciences (ICVIAS) 2021 Seminar Nasional Agroteknologi Fakultas Pertanian UPN “Veteran” Jawa Timur 2021 Join Proceeding "Basic and Applied Science Conference (BASC) 2021 & 1st Education Research and Appli International Seminar of Research Month 2021 International Conference of Social Research with Multidisiplinary Approach (ICSRMA) 2021 4th Economics, Business, and Government Challenges 2021 5th International Seminar of Research Month 2020 3rd Economics, Business, and Government Challenges 2020 1st ICEMAC 2020: International Conference on Economics, Management, and Accounting Seminar Nasional Magister Agroteknologi Fakultas Pertanian UPN “Veteran” Jawa Timur Sains dan Teknologi Pertanian Modern Multi-Conference Proceeding Series B Multi-Conference Proceeding Series A Internationale Konferenz des Indonesischen Germanistenverbandes (iKoniG) International Seminar of Research Month Science and Technology in Publication, Implementation and Co International Seminar of Research Month Science and Technology for People Empowerment. International Conference on Life Sciences and Biotechnology (ICOLIB) International Conference on Global Resource Conservation (ICGRC) Federation of Islamic Medical Associations Bioinformatics and Biodiversity Conferences (BBC) 4th International Seminar of Research Month 2nd International Conference Eco-Innovation in Science, Engineering, and Technology 2nd Bioinformatics and Biodiversity Conference 1st International Conference Eco-Innovation in Science, Engineering, and Technology More Issue