cover
Contact Name
-
Contact Email
-
Phone
-
Journal Mail Official
-
Editorial Address
-
Location
Kota denpasar,
Bali
INDONESIA
International Journal of Biosciences and Biotechnology
Published by Universitas Udayana
ISSN : 23033371     EISSN : 26559994     DOI : -
Core Subject : Science, Social,
International Journal of Biosciences and Biotechnology provides a unique venue for publishing original researches in biosciences and biotechnology, and ensures that authors could reach the widest possible audience. It publishes both full-length articles and short communications on all aspects of biotechnology and biosciences
Arjuna Subject : -
Articles 5 Documents
Search results for , issue "Vol 7 No 2 (2020)" : 5 Documents clear
GROWTH AND YIELD OF FOUR INDONESIAN IMPROVED SOYBEAN VARIETIES BASED ON BIO-DETAS INPUT PACKAGE IN RAINFED LOWLAND OF CENTRAL LOMBOK Nani Herawati; Ai Rosah Aisah; Baiq Nurul Hidayah
International Journal of Biosciences and Biotechnology Vol 7 No 2 (2020)
Publisher : Central Laboratory for Genetic Resource and Molecular Biology, Faculty of Agriculture, Udayana University in cooperation with Asia-Oceania Bioscience and Biotechnology Consortium (AOBBC)

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (247.997 KB) | DOI: 10.24843/IJBB.2020.v07.i02.p03

Abstract

Soybean is one of the most important food crops in Indonesia after rice and corn, due to its protein content reaches 40%. Rainfed lowland can be used as expansion planting area in hopes of obtaining high productivity with efficient inputs. In order to increase yield, it is necessary to apply the Bio-Detas input package that priorities the use of adaptive improved varieties, organic fertilizers and biological pesticides. This research aim to investigate the response of four Indonesian improved soybean varieties based on the application of Bio-Detas input package in rainfed lowland. The experiment was conducted from March to July 2018 in Pengembur Village, Central Lombok Regency of West Nusa Tenggara Province, Indonesia. The experiment was conducted using a non-factorial randomized block design with varieties as treatments, namely Argomulyo, Burangrang, Dega-1, and Dena-1. Each treatment was repeated three times therefore there were 12 experimental plots in total. Parameters observed during the vegetative and generative phases including plant height, number of branches, number of leaves, number of nodus, number of flowers and number of pods. Data were collected from five plants for each replication. Results showed that varieties had a significant influence on the number of leaves, number of nodus and number of flowers during the vegetative phase. While during the generative phase there were a significant effect of varieties on plant height, number of leaves and number of nodus. Due to dry season occurred earlier in April, yield on Bio-Detas input package was reached 578 kg/ha compared to farmer’s existing technology was 393 kg/ha.
ANTIOXIDANT ACTIVITY OF THE TOPICAL PREPARATION OF BULUNG SANGU (Gracilaria spp) EXTRACT Maria Malida Vernandes Sasadara; I Gede Putu Wirawan; Made Sritamin; I Ketut Suada; Wayan Adiartayasa
International Journal of Biosciences and Biotechnology Vol 7 No 2 (2020)
Publisher : Central Laboratory for Genetic Resource and Molecular Biology, Faculty of Agriculture, Udayana University in cooperation with Asia-Oceania Bioscience and Biotechnology Consortium (AOBBC)

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (194.155 KB) | DOI: 10.24843/IJBB.2020.v07.i02.p04

Abstract

Bulung Sangu (Gracilaria spp) as many other macroalgae, is a source of beneficial phytochemical for health. Phytochemicals in macroalgae are widely used as active ingredients in cosmetic preparations. The study was aimed to determine the antioxidant properties of Bulung Sangu formulated in topical preparation. Bulung Sangu was macerated in ethanol 96% following by extract formulation in cream preparation in two concentrations: 5% and 10%. Antioxidant activity was determined against DPPH radical, compared to ascorbic acid. Percentage of reducing power in five concentration series (10, 20, 30, 40, and 50 µm/ml) statistical analyzes using one-way ANOVA with 95% of confidence level, following by IC50 measurement. Absorbance was read in wavelength of 517 nm. Concentration of 5% and 10% cream extract exhibited IC50 of 13,091 µg/ml and 11,867 µg/ml, respectively. These values are lower than IC50 of ascorbic acid (18,505 µg/ml), indicating the strong antioxidant properties of Bulung Sangu extract cream which is more potential than ascorbic acid. Bulung Sangu exhibit a potential source for being developed as medicine and cosmetics in topical preparation.
PRIMER DESIGN OF CVPDr DNA FRAGMENT SEQUENCES THAT AMPLIFY SPECIFIC FRAGMENTS TO DISTINCT THE RESISTANT FRAGMENT FROM Triphasia trifolia (Burm. F.) P. Wils. AND THE SUSCEPTIBLE FRAGMENT FROM Citrus nobilis Lour. Ni Made Ayuratih Utami; I Gede Putu Wirawan; I Ketut Suada
International Journal of Biosciences and Biotechnology Vol 7 No 2 (2020)
Publisher : Central Laboratory for Genetic Resource and Molecular Biology, Faculty of Agriculture, Udayana University in cooperation with Asia-Oceania Bioscience and Biotechnology Consortium (AOBBC)

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (352.022 KB) | DOI: 10.24843/IJBB.2020.v07.i02.p05

Abstract

CVPDr is a DNA fragment that indicates that plants are resistant to CVPD. Previous research using primers that amplified 841 bp CVPDr fragment was able to amplify the fragment from Triphasia trifolia that considers being a resistant plant, Citrus aurantifolia var. seedless which considers being a tolerant plant, and some susceptible citrus plants to CVPD disease. In this study, we designed some primers that amplified only CVPDr DNA fragment from T. trifolia which consider as the resistant plant and a primer that amplified only DNA fragmen from Citrus nobilis which consider as the susceptible citrus plants. The primers for CVPDr on T. trifolia are TCATCTGCATGGGATACC for forward primer and GCCTTGAGCTTGTAAGTG for reverse primer which turned out to amplify the DNA of T. trifolia and also the C. nobilis cultivar Denpasar and only succeeded in not amplifying the C. nobilis cultivar Gianyar. The primers for CVPDr on C. nobilis are GAATGGCTTAGCAGAAAGG for forward primer and GGTTGTAGATGGACATAGG for reverse primer turned out can not only amplify the DNA C. nobilis but also amplify T. trifolia.
IDENTIFICATION OF CITRUS WHITEFLY, HOST OF ENTOMOPATHOGENIC FUNGI (ASCHERSONIA PLACENTA) IN BALI INDONESIA Ni Putu Merthaningsih; I Putu Sudiarta; Gusti Ngurah Alit Susanta Wirya
International Journal of Biosciences and Biotechnology Vol 7 No 2 (2020)
Publisher : Central Laboratory for Genetic Resource and Molecular Biology, Faculty of Agriculture, Udayana University in cooperation with Asia-Oceania Bioscience and Biotechnology Consortium (AOBBC)

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (272.586 KB) | DOI: 10.24843/IJBB.2020.v07.i02.p01

Abstract

One of the pests of citrus is whitefly that, causes damage directly or/and indirectly to the citrus production. To control whitefly the farmer usually use chemical insecticide, however the utilization of chemical insecticide has been reported to haves many negative effect. To minimize the utilization of chemical insecticide, the environmentally friendly method is needed. One of the method is to utilize the natural enemies. Natural enemies are including, parasitiod, predator as well as insect pathogen (entomopathogen). In 2017 entomopathogenic fungi Aschersonia placenta was found to be associated with citrus whitefly in Bali Indonesia. However the species of whitefly has not been identified. In this research the identification of whitefly, the host insect of A. placenta was conducted based on morphological and molecular identification. Morphological identification of whitefly use puparial stage, started with sample preparation by Slide Mounting Protocol. The target of mitochondrial cytochrome c oxidase subunit I (mtCOI) gen was successfully amplified (700 bp) by PCR using forward primer LCO 5'GGTCAACAAATCATAAAGATATTGG3' and reverse primer HCO 5'TAAACTTCAGGGTGACCAAAAAATCA3'. The phylogenetic analysis using software ChromasPRO, Molecular Evolutionary Genetics Analysis (MEGA 5.05), PAUP, BioEdit, and TreeGraph2 was conducted. The result shows that the mtCOI sequence of P. minei from Bali (LC491421) has the highest percentage among others with MK421974 P. minei (score homology 96%). The morphological recognition and sequence analysis show that the species of citrus whitefly is Paraleyrodes minei.
MOLECULAR IDENTIFICATION OF FUNGI THE CAUSAL AGENT OF STRAWBERRY WILT DISEASE IN BALI Gusti Ngurah Alit Susanta Wirya; I Wayan Diksa Gargita; I Putu Sudiarta
International Journal of Biosciences and Biotechnology Vol 7 No 2 (2020)
Publisher : Central Laboratory for Genetic Resource and Molecular Biology, Faculty of Agriculture, Udayana University in cooperation with Asia-Oceania Bioscience and Biotechnology Consortium (AOBBC)

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (385.19 KB) | DOI: 10.24843/IJBB.2020.v07.i02.p02

Abstract

The development of strawberry farming in Bali experiencing some obstacles that cause a decline in production, such as wilting disease. The disease was reported caused by the fungi base on morphological recognition. There are two fungi were recognized caused the strawberry wilt disease in Bali, they are from genus Verticillium and Fusarium. More specific information about causal agent of wilt disease in strawberry especially in Bali is needed. The one accurate identification is done through the molecular approach by analyzing DNA that encode the ribosomal DNA (rDNA). The 18S rDNA, including the internal areas of transcribed spacers (ITS), ITS1 and ITS4 have been widely used in phylogenetic studies. The amplification results of this area produce bands in different sizes that can be used to identify fungal species. Based on that the identification of strawberry wilt disease using molecular analysis was conducted. The 542 bp of Internal Transcribed Spacer (ITS) DNA was successfully amplified using PCR with pairing primers ITS 1 (5-TCCGTAGGTGAACCTGCGG-3’), and ITS 4 (5’-TCCTCCGCTTATTGATATGC-3’). The sequences of three isolates were successfully obtained through sequencing. Homology levels were tested between sequences and showed that Candi Kuning sequence and Gobleg sequence had 95% similarity with sequence of Fusarium oxysporum NRRL 13307 (U34571) from America. While Pancasari sequence have 94% similarity with sequence of Fusarium oxysporum NRRL 13307 (U34571) from America. Candi Kuning, Gobleg, and Pancasari sequences had the same 86% with sequence of Fusarium oxysporum isolate C34-294 Brazil (KJ439088) and had 89% similarity with sequence Fusarium oxysporum f.sp. fragariae China (KT833080). Homology levels were tested between sequences and showed that Candi Kuning sequence and Gobleg sequence had 95% similarity with sequence of Fusarium oxysporum NRRL 13307 (U34571) from America. While Pancasari sequence have 94% similarity with sequence of Fusarium oxysporum NRRL 13307 (U34571) from America. Candi Kuning, Gobleg, and Pancasari sequences had the same 86% with sequence of Fusarium oxysporum isolate C34-294 Brazil (KJ439088) and had 89% similarity with sequence Fusarium oxysporum f.sp. fragariae China (KT833080). Based on phylogeny analysis of Pancasari, Gobleg and Candi Kuning isolates were obtained in one group with Fusarium oxysporum identified in America and Brazil, and also in one group with Fusarium oxysporum f. sp. fragariae that identified in China.

Page 1 of 1 | Total Record : 5