<![CDATA[Neuroglobin (Ngb) is a newly discovered globin that is found in large numbers in neurons. Brain cells are very sensitive to lack of oxygen and can begin to die within five minutes after the oxygen supply is cut off. hypoxic conditions of brain tissue are ischemic in the area of the bleeding center. This study aims to design and analyze the expression of the Neuroglobin Rattus norvegicus mRNA gene in silico as a nucleotide that is able to read neuroglobin gene expression due to hypoxic states. The neuroglobin gene sequence was obtained using a "nucleotide" search menu provided by NCBI GenBank and designed using Geneious Prime bioinformatics software. The neuroglobin gene sequence used in this study was Rattus norvegicus mRNA with accession number NM_033359.3|:1-1,773. Synthesized primary pairs are optimized using PCR gradients. PCR products were analyzed by electrophoresis using 1.5% agarose gel, 100 V for 27 minutesThe results obtained one forward primer for Rattus norvegicus neuroglobin (Ngb) which has a length of 20 bases with the order of 5' AGTCTTAGCCTCTCCCCCAG -3' and reverse primer has a length of 20 bases with the order of 5' GTCTACAGAACCACGGCACAcx-3' product size 803 bp. The difference Tm in this pair of primers is 0.9 0C. The gradient PCR results showed the thickest and clearest DNA bands were at 57.7°C. Primers with the best primary criteria for neuroglobin genes were obtained with an amplicon size of 803 bp and an aneealing temperature of 57.7 °C. The design results meet the requirements of good criteria so that the primary candidate design results can be used for the PCR process.]]>
Copyrights © 2023
