cover
Article Per Year (5 Year)
All
Home Page
OAI Link
Editorial Team
Contact
Reviewer
Google Scholar
Contact Name
-
Contact Email
-
Phone
-
Journal Mail Official
mjhr@ui.ac.id
Editorial Address
ILRC Building, 1st Floor, Universitas Indonesia, Depok 16424, Indonesia
Location
Kota depok,
Jawa barat
INDONESIA
MAKARA of Health Series
Published by Universitas Indonesia
ISSN : -     EISSN : 23563656     DOI : 10.7454
Core Subject : Health,
Health Professions
Arjuna Subject : -
Articles 289 Documents
 1   2   3   4   5 
Negotiating Motherhood: The Difficulties and Challenges of Rural First-Time Mothers in Parung, West Java Yati Afiyanti
Makara Journal of Health Research ##issue.vol## 6, ##issue.no## 1 (2002): June
Publisher : Universitas Indonesia

Show Abstract | Download Original | Original Source | Check in Google Scholar

Abstract

A hermeneutic phenomenological study was carried out to explore the difficulties and challenges of being a first-time mother in a rural area in Indonesia. The purposes of the present study were to provide health care providers with a greater understanding of the difficulties and the challenges of early motherhood. The thirteen Indonesian women who participated in this study described their experiences of first-time motherhood during early motherhood. Data were collected through semi structured conversational interviews. Three majors difficulties and challenges were identified: (1) being a new mother is not easy (2) a new mother is not as free as she was before and (3) trying to be a good mother. These challenges have offered insight, information and understanding into the experiences of Indonesian women with early motherhood. Also, this study will give a richer and deeper understanding of the needs of women during this period and about their feelings on the mothering role, which is useful for health care providers and others, who are concerned about this issue.
Bacteriocin Activity of Leuconostoc mesenteroides Pbac1 Bacteria on Several Media Kusmiati Kusmiati; Amarila Malik
Makara Journal of Health Research Vol 6, No 1 (2002): June
Publisher : Universitas Indonesia

Show Abstract | Download Original | Original Source | Check in Google Scholar

Abstract

Bacteriocin is a proteinaceous compound that has bactericidal action against microorganisms. Bacteriocins from lactic acid bacteria are very potential as natural food biopreservatives. The aim of the research was to know the infl uence of the growth medium; MRS, CMG, LTB and CM on antimicrobial activity of Leuconostoc mesenteroides Pbac1. Growth inhibition zone determination has been carried out by antagonism assay, as well as diffusion method using Lactobacillus plantarum, Leuconostoc mesenteroides, Staphylococcus aureus, Lactobacillus pentosus and Lactobacillus acidilactici as indicator strains. The results showed that L. plantarum and L. acidilactici were the sensitive indicators. The best growth medium for antagonism assay of the two sensitive indicator bacteria was MRS, which showed inhibition zone diameter of 1.28 cm and 1.23 cm, respectively. The most active supernatant was produced by L. mesenteroides Pbac1 grown on MRS, which inhibited the growth of L. plantarum and L. acidilactici with respective zone diameter of 1.28 cm and 1.19 cm. Bacteriocin titre activity against sensitive indicator bacteria was 100 AU/ml. Based on the result, MRS was further utilized to study the effect of the different carbon sources i.e glucose, maltose and mannose on bacteriocin activity of L. mesenteroides Pbac1. The results showed that glucose was the best carbon source as indicated by the widest diameter of inhibition zone, i.e 1.23 cm, against both indicator strains. Bacteriocin titre activity of the latter study was 100 AU/ml.
Intenstinal Parasitic Infections in Primary School in Pulau Panggang and Pulau Pramuka, Kepulauan Seribu Adi Sasongko; Heksa Irawan; Rahmi Tatang; Rizal Subahar; Purnomo Purnomo; Sri Margono
Makara Journal of Health Research Vol 6, No 1 (2002): June
Publisher : Universitas Indonesia

Show Abstract | Download Original | Original Source | Check in Google Scholar

Abstract

Stool samples were collected and examined for soil-transmitted helminthic and protozoal infection in the first grade of three primary schools, located on Pulau Panggang and Pulau Pramuka, which are parts of a group of islands not far from the north coast of Jakarta. The stool examinations were part of activities during a control program on soil-transmitted helminthic infections. The schools have never participated with control programs on soil-transmitted helminthiases. For the examination of the samples a semi-quantitative Kato thick smear method was used and the direct smear with a 2% iodine solution. Four intestinal helminth species and five protozoa species were found in a total of 101 stool samples. Ascaris and Trichuris infections were found in 68.8% or more. Hookworm infection was only found in one school (2.9%). Eggs of Hymenolepis nana were detected in one sample. Cysts of Entamoeba histolytica and Entamoeba coli were both found in 5.0% of the samples, whereas Endolimax nana was recovered from 2.0% of the samples. High prevalence rates were detected for Blastocystis hominis (36.0%) and for Giardia lamblia it was 30.0%. Most of the Ascaris infections were categorized as light infections at School I (69.0%) and not a single heavy infection were found in this school. In School II and III most of the infections were moderate i.e. respectively 51.4 and 81.8%. Also in Schools II and III heavy infections were detected, respectively 11.4 and 5.8%. Fertilized Ascaris eggs were detected in 93.1%, 100% and 95.5% at School I, II and III respectively. As a whole among 86 positive samples 96.5% were recorded as samples with fertilized eggs, whereas 3.5% contained unfertilized eggs. The high prevalences of Ascaris and Trichuris infections in this area could be expected due to the low level of environmental hygiene and sanitation. Among the protozoal infections B. hominis and G. lamblia were the dominant species.
Mother’s and Children Aged 3-5 Years Old Food Habits in Higher and Lower Socio-Economic Status in Rambutan, District of Penggilingan, East Jakarta Fatmah Fatmah; Nurasiah Nurasiah
Makara Journal of Health Research Vol 6, No 1 (2002): June
Publisher : Universitas Indonesia

Show Abstract | Download Original | Original Source | Check in Google Scholar

Abstract

A food habits study is reported from 60 respondents in the urban areas. A qualitative approach was undertaken to explore factors influencing food habits and to compare it within low and high socioeconomic status (SES) by using Focus Group Discussion (FGD) and indepth interview. One fifth of the overweight mothers (low and high SES) showed a similar condition as follow: they had low to moderate physical activity (they worked in a relatively small house and they spent 2-3 hours per day for watching television), they consumed snacks continuously for a whole day, and they ate left-over food of their children or husbands. One fifth of the underweight children 2-5 years old from both SES showed similar situation: they suffered from infectious disease (ARI, TBC, and bronchitis); they played a lot; and they lost appetite eating main meals after they consumed snacks. The high SES under-fives were more likely to buy snacks which were high in calorie such as hamburger, fried chicken, fried potatoes. While the low SES under-fives bought snacks which were considered as “empty calorie” i.e. jelly, and candy. Both condition above caused the difference of nutritional status among mothers and their children. Mothers had double burden (underweight and overweight), while their children 2-5 years age suffered from under-nutrition (20%).
The Effect of Coumarin Derivate from the Stem Bark of Calophyllum biflorum on the In Vivo Growth of Transplantable C3H Mammary Tumor Cells Lies Wibisono
Makara Journal of Health Research Vol 6, No 1 (2002): June
Publisher : Universitas Indonesia

Show Abstract | Download Original | Original Source | Check in Google Scholar

Abstract

Calanone, is a coumarin derivate which was isolated from the stem bark of Calophyllum biflorum.To know the effect of calanone on the in vivo growth of transplantable C3H mammary tumor cells, C3H mice were used which were divided into : one group of untreated control, one group of solvent control (injected with 0,1 mL PEG 400) and four treated groups, each of which were injected subcutaneously near the tumor with 0,1 mL of 1 mg/mL, 2 mg/mL, 4 mg/mL, and 8 mg/mL of calanone in PEG 400 solvent respectively. The injections were given three times a week, for four weeks. By using Friedman test, for non parametric statistical analysis of the weekly observed tumor volume, it was shown that there was a significant decrease in the tumor growth of the group treated with calanone solution of 4 mg/mL dosage, compared to the control or other groups.
Direct MN Test on Peripheral Blood to Detect Chromosomal Breakage: Application in Smokers Jeanne Adiwinata Pawitan; Retno Wilujeng Susilowati
Makara Journal of Health Research Vol 6, No 2 (2002): December
Publisher : Universitas Indonesia

Show Abstract | Download Original | Original Source | Check in Google Scholar

Abstract

The purpose was to assess chromosomal damage in blood mononuclear cells of smokers. Smoker’s peripheral blood samples were screened for micronuclei. Samples from smokers who had an illness were excluded. From each sample, 500 swelled mononuclear leucocytes were screened using a light microscope, with 400x magnification. Frequency distribution of subjects having 0, 1, 2, 3, 4, and 5 micronuclei (MN) according to age and condition were tabulated. From the 102 samples, 5 were excluded, and only 97 were analyzed. There was an increase in MN count in 12.8%, 12.9%, 33.3%, and 25% of normal smokers living in unpolluted area, hypertensive smokers living in unpolluted area, normal smokers living in polluted area, and hypertensive smokers living in polluted area, respectively. Therefore, there was a tendency of increasing MN count in smokers in the productive age group, hypertensive people, and people living in polluted area.
Dislipidemia in Elderly in Padang City Sudijanto Kamso; Purwantyastuti Purwantyastuti; Ratna Juwita
Makara Journal of Health Research Vol 6, No 2 (2002): December
Publisher : Universitas Indonesia

Show Abstract | Download Original | Original Source | Check in Google Scholar

Abstract

Cardiovascular disease has become the first cause of death. Highest morbidity is found in the elderly. Many studies on the relationship between dyslipidemia and cardiovascular disease has been done, however studies on prevalences of dyslipidemia among the elderly in Indonesia are lacking. Therefore, there is an urgent need to obtain information on dyslipidemia in the Indonesian elderly, which will allow the policy makers to provide appropriate intervention programs against cardiovascular diseases. The primary purpose of this study was to the observe prevalence of dyslipidemia among the aged in Padang, an area with high prevalence of cardiovascular diseases. A cross sectional study was undertaken in Padang with a total sample of 205 elderly using multistage random sampling. Subjects were recruited from free living elderly population. Data were collected through interviews using structured questionaires, anthropometric measurements, biochemical blood analysis, and blood pressure measurements. Data were analyzed by using SPSS programs for Windows version 7.5. Prevalence of dyslipidemia (hypercholesterolemia and LDL-cholesterolemia) found in the study was quite high, more than 50% of the study population. The ratio of total cholesterol to HDL cholesterol (≥ 5) was also quite high in the study population (47.6%). Nutrition education to elderly group should emphasize healthy nutrients with protecting effect against dyslipidemia. Suggestion for proper physical activity as a protecting factor against hypertension is very important for the elderly. Regular checking of plasma lipid should be conducted for early detection of cardiovascular disease risk factors. Future studies should be directed on public health and nutrition intervention to the elderly community.
Candida Isolation from Stools of HIV/AIDS Patients Mulyati Mulyati; Retno Wahyuningsih; Widiastuti Widiastuti; Pudji Sjarifuddin
Makara Journal of Health Research Vol 6, No 2 (2002): December
Publisher : Universitas Indonesia

Show Abstract | Download Original | Original Source | Check in Google Scholar

Abstract

Candida is a saprophyte in the human respiratory tract, gastro intestinal tract and also in the debris under the nail. In patients with compromised immunity such as HIV-AIDS, Candida is able to cause infection, in this case oral candidosis or esophagitis. In this study fungi were isolated from the stools of HIV/AIDS patients. Samples consisting of 95 diarrheic stools from HIV/AIDS patients were investigated for the yeast especially Candida spp. The stools were inoculated onto Sabouraud dextrose agar then the fungi were identified using morphological methods and Chromagar medium. Yeast colonies were found in 71 (74,74%) out of 95 samples from which Candida was 42 (44,21%), Geotrichum 24 (25,26%), and mixed of Candida and Geotrichum 3 (3,16%), Rhodotorula and Trichosporon 1(1,05%) each. Species of Candida were identified as C. albicans, C. tropicalis, C. krusei, C. guilliermondii, C. glabrata, C. lusitaniae and C. kefyr. Although Candida could be isolated from the diarrheic stools of HIV/AIDS patients but its role on the cause of diarrhea is still questionable.
The Elderly’s Coping to the Decrease of Musculosceletal Function at Kelurahan Cipinang Muara, Kecamatan Jatinegara, East Jakarta. Astuti Yuni Nursasi; Poppy Fitriyani
Makara Journal of Health Research Vol 6, No 2 (2002): December
Publisher : Universitas Indonesia

Show Abstract | Download Original | Original Source | Check in Google Scholar

Abstract

The elderly’s coping to the decrease of musculosceletal function at Kelurahan Cipinang Muara, Kecamatan Jatinegara, East Jakarta. The elderly naturally experiences the decrease of musculosceletal function as consequences of physical changes process. Frequently, these changes cause some disturbances like limited mobilization and their productivity. For some circumstances, it causes stressfull moment for them. These stressors motivate the elderly to adjust to the situation, which is named coping. The purpose of this study is to identify the coping strategy which is used by the elderly to cope with the decrese of musculosceletal function. This study conducted at RW 05, RW 08, and RW 11 at Kelurahan Cipinang Muara, Kecamatan Jatinegara, East Jakarta. The participants’ age range between 60-89 years old. Mostly are women (65.2%). Their marital status varied from married (52.17%), widows (41.30%), and widowers (6.52%). The questionnaire was developed using the ways of coping instrument by Folkman and Lazarus. These coping consist of confrontative, seeking social support, planful problem solving, self control, distancing, positive reappraisal, accepting responsibility, and escape/avoidance. The result shows that the participants used all those types of coping.The age does not determine the coping that they have been used. Most participants use adaptive coping, while the mal adaptive coping is used by 30.43% for self control; 13.04% for distancing; and 63.04% for escape/avoidance. In contrast, gender demonsrates the significant differences. Elderly female put a lot efforts to cope with their limited mobilization. They use confrontative(47.83%) and seeking social support (36.96%). Elderly male only use confrontative (21.7%) and seeking social support (36.96%).
Assessing Minimal Concentration of Toxoplasma Gondii B1 and P30 Gen Which Are Still Detectable By Polymerase Reaction Chain Lisawati Susanto; Taniawati Supali; Srisasi Gandahusada
Makara Journal of Health Research Vol 6, No 2 (2002): December
Publisher : Universitas Indonesia

Show Abstract | Download Original | Original Source | Check in Google Scholar

Abstract

Toxoplasma gondii is an intracellular protozoan which causes toxoplasmosis. A serological test (ELISA) for detecting the presence of IgG and IgM antibodies against T.gondii is usually performed nowadays, however this serological test is not adequate. Therefore an accurate laboratory test is needed for diagnosing acute toxoplasmosis, and in this case the polymerase chain reaction (PCR) is the method of choice. The aim of this study is to assess the minimal concentration of the DNA of T.gondii which still can be detected by the PCR using B1 and P30 genes as targets. The PCR against B1 gene as target was performed by using the method described by Chang & Ho. Two methods described by Weiss et al and Chang & Ho were used against P30 gene as target. The B1 gene primers consisted of oligo 1 :5’GGAACTGCATCCGTTCAGA G3’ and oligo 2 : 5’TCTTTAAAGCGTTCGTGGTC3’, whereas the P30 gene primers consisted of oligo 1 : 5’CACACGGTTGTATGTCGGTTTCG CT3’ and oligo 2 : 5’TCAAGG AGCTCAAT GTTACAGCCT3’. It was shown that no specific bands were observed in the PCR with P30 gene as target using the method by Weiss et al. With the method Chang & Ho the electrophoresis did not show any band when 30, 35, 40 and 45 cycles of PCR were used however, by using 50 cycles a specific band was observed. It was concluded that the assay using B1 gene as target was more sensitive than the one using P30 gene as target.

Page 1 of 29 | Total Record : 289

 1   2   3   4   5 

Filter by Year

2001 2019


Reset
Filter By Issues
All Issue Vol 23, No 1 (2019): April Vol 22, No 3 (2018): December Vol 22, No 2 (2018): August Vol 22, No 1 (2018): April Vol 21, No 3 (2017): December Vol 21, No 2 (2017): August Vol 21, No 1 (2017): April Vol 20, No 3 (2016): December Vol 20, No 2 (2016): August Vol 20, No 1 (2016): April Vol 19, No 3 (2015): December Vol 19, No 2 (2015): August Vol 19, No 1 (2015): April Vol 18, No 3 (2014): December Vol 18, No 2 (2014): August Vol 18, No 1 (2014): April Vol 17, No 2 (2013): December Vol 17, No 1 (2013): June Vol 16, No 2 (2012): December Vol 16, No 1 (2012): June Vol 15, No 2 (2011): December Vol 15, No 1 (2011): June Vol 14, No 2 (2010): December Vol 14, No 1 (2010): June Vol 13, No 2 (2009): December Vol 13, No 1 (2009): June Vol 12, No 2 (2008): December Vol 12, No 1 (2008): June Vol 11, No 2 (2007): December Vol 11, No 1 (2007): June Vol 10, No 2 (2006): December Vol 10, No 1 (2006): June Vol 9, No 2 (2005): December Vol 9, No 1 (2005): June Vol 8, No 2 (2004): December Vol 8, No 1 (2004): June Vol 7, No 2 (2003): December Vol 7, No 1 (2003): June Vol 6, No 2 (2002): December Vol 6, No 1 (2002): June ##issue.vol## 6, ##issue.no## 1 (2002): June Vol 5, No 2 (2001): December Vol 5, No 1 (2001): June More Issue