Article Per Year (5 Year)
p-Index From 2019 - 2024
1.037
P-Index
This Author published in this journals
All Journal Jurnal Farmasi Sains dan Komunitas (JFSK) JSFK (Jurnal Sains Farmasi & Klinis) JPSCR : Journal of Pharmaceutical Science and Clinical Research Journal of Tropical Pharmacy and Chemistry Jurnal Sains dan Kesehatan
Nuur Aanisah
Department Of Pharmacy, Faculty Of Mathematics And Natural Sciences, Tadulako University, Indonesia
Agriculture, Biological Sciences & Forestry Biochemistry, Genetics & Molecular Biology Chemical Engineering, Chemistry & Bioengineering Environmental Science Health Professions Immunology & microbiology Medicine & Pharmacology Public Health

Published : 5 Documents Claim Missing Document
Claim Missing Document
Check
Articles

Found 5 Documents
Search

 1 
Primer Design and Analysis for Detection of mecA gene Armini Syamsidi; Nuur Aanisah; Reyhan Fiqram; Imanuel Al Jultri
Journal of Tropical Pharmacy and Chemistry Vol. 5 No. 3 (2021): Journal of Tropical Pharmacy and Chemistry
Publisher : Faculty of Pharmacy, Universitas Mulawarman, Samarinda, Indonesia, 75117, Gedung Administrasi Fakultas Farmasi Jl. Penajam, Kampus UNMUL Gunung Kelua, Samarinda, Indonesia

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.25026/jtpc.v5i3.297

Abstract

MecA is a gene that causes antibiotic resistance and it contained in Staphylococcus aureus. The gene can be detected using pairs of primer (forward and reverse). Primes is short nucleotide that are used as attachment point for DNA polymerase and as a barrier for the fragment DNA target to be amplified with Polymerase Chain Reaction (PCR). The aims of this study were to design and analysis the nucleotide primer sequences of MecA. This research using in silico method of NCBI (National Center of Biotechnology Information) application, clone manager10, oligoanalyzer3.1, perlprimer and primer3plus. The results of design and candidate primer analysis showed that the first candidate of forward and reverse primer that falls with in the criteria with base sequences 18-30, 40-60 GC%, Tm 50-60, 3’ dimer ?3, stability ?1,2, secondary structure >-16 Kcal/mol, runs ?5, repeats ?4, hairpins>-3 Kcal/mol. The conclusion is the first candidate of forward primer with 19 base pair (5’GTGAAGCAACCATCGTTAC'3), %GC 47Tm 58oC, 3’dimer 2, stability 1.6, secondary structure -1,95 dan -3,61 Kcal/mol, runs 2, hairpins -0,1 start 53844 and the first candidate of reverse primer with 21 base pair (5’CCTTCTACACCTCCATATCAC'3), %GC 47, Tm 58oC, 3’dimer 0, stability 1.3, secondary structure -4,74 dan -5,38 Kcal/mol, runs 2, hairpins -2.5 dan start 55852. The both of primer can be use for identification of MecA gene by PCR method
Pemanfaatan Ekstrak Buah Kaktus (Oputian elatior Mill.) sebagai Pewarna Alami pada Sediaan Lipstik Nuur Aanisah; Evi Sulastri; Yusriadi Yusriadi; Friskilla Friskilla; Armini Syamsidi
Jurnal Sains dan Kesehatan Vol. 2 No. 4 (2020): Jurnal Sains dan Kesehatan
Publisher : Fakultas Farmasi, Universitas Mulawarman, Samarinda, Indonesia

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (681.614 KB)

Abstract

Cactus fruit (Opuntia elatior Mill) is a flowering plant of the Cartacae family, which grows in high and dry plateau known to contain betacyanin compound, which is a natural dye of red color. The aim of this research is to identify the physical and chemical characteristics of betacyanin extract of cactus fruit on lipstick ingredients. The examination of physical and chemical characteristics includes organoleptic testing, homogeneity, melting point, pH, lipstick smearing, lipstick hardness and betacyanin levels in the lipstick. Observations were made on the first day and the seventh day of storage. The test results show red lipstick ingredients with a distinctive aroma of the betacyanin extract and densely dispersed homogenous texture. Meanwhile, the melting point test showed lipsticks melt at the temperature of 70°C, with pH value of the first day is 5,86 and the seventh day that is 6,13, polishing evenly and obtained lipstick 90g lipstick hardness level. The result of betacyanin content on the first day is 0.195 mg / 100gram, and on the seventh day is 0.105 mg / 100gram. In conclusion, lipstick produce with betacyanin extract of cactus fruit has good physical stability in accordance with SNI 16-4769-1998 about the ingredients of lipstick (Indonesian National Standard).
Modifications and Pharmaceutical Applications of Glucomannan as Novel Pharmaceutical Excipient in Indonesia: Review Article Nuur Aanisah; Yoga Windhu Wardhana; Anis Yohana Chaerunisa
JPSCR: Journal of Pharmaceutical Science and Clinical Research Vol 7, No 2 (2022)
Publisher : Universitas Sebelas Maret

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.20961/jpscr.v7i2.56076

Abstract

Currently, Indonesia is excessively dependent on imported raw materials, such as pharmaceutical excipients. In this regard, the current pandemic should remind the critical nature of independence in purchasing raw resources to cope with future dynamics. One of the causes of dependence is the lack of raw materials management, specifically from biological sources abundantly available. A significant advantage is directed towards natural excipients because large quantities of more affordable plants ensure sustained availability in nature. Therefore, this study highlighted the possibility of using excipients derived from natural resources that are commonly used yet underutilized in Indonesia, such as glucomannan (GM). Indonesia has the potential to produce GM, considering the high natural resources as its source. However, it has not been applied extensively in pharmaceutical preparations due to diverse uses in several countries' drug, food, and cosmetic industries. This study aimed to discuss the modifications of GM and their use as pharmaceutical excipients with better physical properties. Additionally, the potential of melinjo seeds that have not been widely used was also analyzed. Melinjo seeds can be used as a source of GM due to their fairly large polysaccharide of about 64.11%. This issue will promote national autonomy in developing novel pharmaceutical excipients derived from natural resources that are highly economical and innovative.
In-vitro Sun Protecting Factor of Rice Bran Oil and Its Formulation as Compact Powder Armini Syamsidi; Evi Sulastri; Yusriadi Yusriadi; Pramita Putri; Nuur Aanisah
Jurnal Sains Farmasi & Klinis Vol 10, No 1 (2023): J Sains Farm Klin 10(1), April 2023
Publisher : Fakultas Farmasi Universitas Andalas

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.25077/jsfk.10.1.54-61.2023

Abstract

This study aims to determine the effective concentration of rice bran oil which can protect against ultraviolet (UV) rays as well as formulate it in compact powder preparation followed by determination of its Sun Protecting Factor (SPF) value. Rice bran samples were extracted using the Soxhlet extraction method with n-hexane: ethanol (1:1) as the solvent. Further identification of the γ-oryzanol in rice bran oil was carried out using TLC silica gel GF254 with eluent of n-hexane:ethyl acetate (3:1). The obtained γ-oryzanol in rice bran oil was used as the ingredient to develop the compact powder which is made into five formulas with 0,05 %-0,25 % concentration. All formulas were characterized, including homogeneity, adhesion and crack test. UV-Visible spectrophotometry was used to determine the SPF value of rice bran oil and its compact powder. The identification results demonstrated a positive presence of the chemical γ-oryzanol in the rice bran oil. At concentrations of 500, 1000, 1500, 2000, and 2500 ppm, rice bran oil may protect against UV rays with SPF values ranging from 1.741 to 11.884. The result showed that all formulas dispersed homogeneously, performed well in terms of compactness, and had no breaks or cracks discovered. Meanwhile, the SPF values of all formulas are found to be 1.390 and 1.274. The results indicate that the SPF values are shallow and are included in the minimal SPF category (2-4) in protecting against UV rays.
Development and Evaluation of Microemulsion-Based Sunscreen Cream Containing Lycopene from Tomato (Solanum lycopersicum L.) Ritha Pratiwi; Nandiska Maladjili; Evi Sulastri; Yusriadi Yusriadi; Nuur Aanisah; Armini Syamsidi
Jurnal Farmasi Sains dan Komunitas (Journal of Pharmaceutical Sciences and Community) Vol 20, No 1 (2023)
Publisher : Sanata Dharma University

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.24071/jpsc.003807

Abstract

This study aimed to formulate and determine the sun protection factor (SPF) of sunscreen made from tomato lycopene microemulsion creams. Lycopene was used as the active ingredient with varying concentrations in each formula, namely F1 5%, F2 7.5%, and F3 9%. The preparation of each formula was evaluated by conducting the globule size, polydisperse index, organoleptic test, homogeneity test, pH test, spreadability test, viscosity test, and determination of SPF value. The average globule size was 119 nm which had a uniform size distribution. The physical characteristics test of the cream preparations showed the three had a bright yellow color and lacked odor. The pH test results were 3.2 ± 0.12, 5.54 ± 0.25, 6.48 ± 0.22 for F1, F2, F3, respectively. Viscosity test results were F1 40,893.33 cPs, F2 41,746.67 cPs, and F3 43,106.67 cPs. The values obtained from the dispersion test were F1 6.71±0.63, F2 5.58±0.15, and F3 4.81±0.11. Moreover, F3 with a concentration of 9% tomato lycopene microemulsion met the acceptance criteria for all of the physical properties including low viscosity to promote good spreadability, pH that does not irritate the skin, aesthetic appeal, small particle size, and non-odorous and an SPF value of 4.9. The obtained microemulsion-based sunscreen cream exhibited a good physical property of lycopene besides showing sufficient SPF value.
Co-Authors Anis Yohana Chaerunisa Armini Syamsidi Evi Sulastri Friskilla Friskilla Imanuel Al Jultri Nandiska Maladjili Pramita Putri Reyhan Fiqram Ritha Pratiwi Yoga Windhu Wardhana Yusriadi Yusriadi Yusriadi Yusriadi Yusriadi Yusriadi