cover
Article Per Year (5 Year)
All
Home Page
OAI Link
Editorial Team
Contact
Reviewer
Google Scholar
Contact Name
Andika Aliviameita
Contact Email
medicra@umsida.ac.id
Phone
+6287888333053
Journal Mail Official
medicra@umsida.ac.id
Editorial Address
Jl. Mojopahit No.666B, Sidoarjo, Jawa Timur
Location
Kab. sidoarjo,
Jawa timur
INDONESIA
Medicra (Journal of Medical Laboratory Science/Technology)
Published by Universitas Muhammadiyah Sidoarjo
ISSN : 25807730     EISSN : 25807730     DOI : https://doi.org/10.21070/medicra
Core Subject : Health,
Health Professions Public Health
Focus : to facilitate scholar, researchers, and lecturers for publishing the original articles of review articles. Scope : Medicra publishes research articles in the field of “medical laboratory (science/technology)” with the following scope: Clinic Chemical Hematology Microbiology Parasitology Immunology Food and beverage analysis Chemical Molecular Diagnostics Toxicology Cytology Histology Epidemiology Laboratory Management Laboratory Quality Control
Arjuna Subject : Profesi Kesehatan - Teknologi Laboratorium Medis
Articles 6 Documents
 1 
Search results for , issue "Vol 3 No 2 (2020): December" : 6 Documents clear
Effectiveness of Ethanolic Extract of Aloe Vera Leaves against Staphylococcus aureus Viki Ayu Intan Permatasari; Mutia Hariani Nurjanah; Wimbuh Tri Widodo
Medicra (Journal of Medical Laboratory Science/Technology) Vol 3 No 2 (2020): December
Publisher : Universitas Muhammadiyah Sidoarjo

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.21070/medicra.v3i2.760

Abstract

Since long ago Indonesia used nutritious plants as traditional medicines. Various types of plants in Indonesia can be used as alternative ingredients, one of which is aloe vera. Aloe vera contains saponin and anthraquinone, so aloe vera leaves function as antiseptic and antibacteria. Staphylococcus aureus is a gram-positive coccus bacteria. This bacterium is often found as a normal germ flora in humans. Staphylococcus aureus can cause infections in humans and animals. This study aims to determine the effect of ethanolic extract of Aloe vera leaves in inhibiting Staphylococcus aureus by using maceration extract method. The concentrations used were 20%, 40%, 60%, 80% and 100% with positive control (Erytromycin) and negative control (aquades). The inhibitory zone analysis is done using the table method. Test of ethanol extract of Aloe vera leaves in inhibiting Staphylococcus aureus produced inhibition zones at concentrations of 60%, 80% and 100% with average diameter of 6.94 mm, 6.22 mm and 9.5 mm. The conclusion of this research is the ethanolic extract of Aloe vera leaves can inhibit Staphylococcus aureus in high concentrations
Correlation Between Personal Hygiene And Hemoglobin Levels On Typhoid Fever Suspect Patients At Lirboyo General Hospital Indana Farodis; Mely Purnadianti
Medicra (Journal of Medical Laboratory Science/Technology) Vol 3 No 2 (2020): December
Publisher : Universitas Muhammadiyah Sidoarjo

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.21070/medicra.v3i2.800

Abstract

Personal Hygiene is an effort made by individuals in maintaining personal hygiene to avoid disease. Personal Hygiene is closely related to typhoid fever, because its transmission can be through food and drinks which are contaminated with Salmonella typhi. WHO and UNICEF ​​on 2015 ranked Indonesia as the second worst sanitation country in the world after India. One of the laboratory tests which is used to observe anemia levels and polycythaemia is hemoglobin degree. The purpose of this study was to analyze the correlation between personal hygiene and hemoglobin levels on typhoid fever suspect patients at Lirboyo General Hospital. The research method used analytic survey with Cross Sectional Study approach and purposive sampling used as the sampling technique with 38 respondents. The results of the study mostly have worst personal hygiene quality of 31 people (81.6%) while respondents have good personal hygiene quality of 7 people (18.4%) and the of hemoglobin category on patients stated normal in 29 people (76.3%) while patients who have abnormal hemoglobin category in 9 people (23.7%). Based on statistical tests on personal hygiene by hemoglobin showed 0.876 p-value and > 0.05 sig value Conclusion which indicated no correlation between personal hygiene and hemoglobin on typhoid fever suspect at Lirboyo General Hospital.
In-Vitro Sunscreen Activity of White Turi Leaf Acetone (Sesbania grandiflora (L.) Pers.) Extract Muhammad Said Agil Siroj; Jamilatur Rohmah
Medicra (Journal of Medical Laboratory Science/Technology) Vol 3 No 2 (2020): December
Publisher : Universitas Muhammadiyah Sidoarjo

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.21070/medicra.v3i2.852

Abstract

Sunscreens are cosmetic preparations that protect the skin from exposure to UV radiation resulting in erythema , skin burning , aging and skin cancer. Leaf of Sesbania grandiflora (L.) Pers. contain phenolic compounds such as tannins and flavonoids which act as photoprotective . This research method is experimental with quantitative descriptive analysis. The purpose of research is to know the value of SPF, transmission erythema (% Te) and pigmentation (% Tp) of acetone extracts of Sesbania grandiflora (L.) Pers. using Spectrophotometry UV -Vis at a wavelength of 280-400 nm with intervals of 5 nm. This study variations in extract concentration were made 100, 200, 400, 600, 800 and 1000 ppm. The results showed the SPF value of extracts of all concentrations in a row was 1.9 ( minimum ); 3.6 ( minimum ); 15.9 ( moderate ); 56.3 ( high ); 133.9 ( high ); and 136.6 ( high ). The %Te value is 400 ppm ( fast tanning ), 600 ppm ( regular suntan ) and 1000 ppm ( extra protection ). The value of %Tp at all extract concentrations is included in the category total block .
Identification of the Mitochondrial ND1 Gene Carrier of Diabetes Mellitus Type 2 with Blood Samples Hindah Sabrina Amin; Miftahul Mushlih
Medicra (Journal of Medical Laboratory Science/Technology) Vol 3 No 2 (2020): December
Publisher : Universitas Muhammadiyah Sidoarjo

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.21070/medicra.v3i2.873

Abstract

Diabetes Mellitus is a condition where there is an increase in blood glucose levels which is characterized by impaired insulin production or the inability of target tissues to respond to insulin. The purpose of this study was to determine the characteristics of the NADH Dehydrogenase 1 gene in the family of Type 2 Diabetes Mellitus patients. The study used a descriptive exploratory method. The sample came from a family of 5 people with T2D in Sidoarjo. Mitochondrial Genotype Analysis using PCR-Primary Sequencing Forward 5'GAGCAGAACCCAACCTCCGAGCAG3 '(nt2826–2849) and Primary Rivers 5'GATTGTTTGGGCTACTGCTCG3' (nt3728 - 3749). Analysis of the 5 samples used obtained 2 samples that can be analyzed with a band length of 690 bp and 84 bp. Based on the results of primary research, the sample used is difficult to get good amplification results. Only one out of five samples can be amplified properly. The variation of the amplified ND1 gene is found at positions T3031C, G3143C, A3252G, C3303T, C3707T.
Potential Analysis Of Toxoplasmosis Distribution In Wild Cats (Felis silvestris) In Some Markets Of Sidoarjo District Through Microscopic Identification Of Toxoplasma gondii Rizal Zakaria; Syahrul Ardiansyah
Medicra (Journal of Medical Laboratory Science/Technology) Vol 3 No 2 (2020): December
Publisher : Universitas Muhammadiyah Sidoarjo

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.21070/medicra.v3i2.890

Abstract

There are many diseases caused by parasitic infection, one of them is toxoplasmosis which is a zoonotic disease. This study was to determine the potential spread of wild cat toxoplasmosis in several markets. The sample used in this study were 24 stray cats taken from the Larangan market, Suko market and Sukodono market in Sidorajo district, using a method of determining the size of the sample based on incidental sampling. Sample were examined using the floating method.The prevalence result obtained from Larangan market (37,5%), Suko market (37,5%) and Sukodono market (12,5%). Prevalence result in Larangan market and Suko market greater than in Sukodono market, this is due to environmental factors in Sukodono market cleaner and better sanitation. Human can become infected with oocyst if they consume food or inhale particle contaminated with T.gondii parasites. High number of cat with oocyst T.gondii can be caused by a dirty environment.
Relationship between Blood Pressure and Urine Protein in Preeclampsia at Prima Husada Hospital Sidoarjo Andreas Putro Ragil Santoso; Nur Masruroh; Ikke Nanda Amalia; Wesiana Heris Santy
Medicra (Journal of Medical Laboratory Science/Technology) Vol 3 No 2 (2020): December
Publisher : Universitas Muhammadiyah Sidoarjo

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.21070/medicra.v3i2.1081

Abstract

The problems related to pregnancy and childbirth including maternal and infant mortality rates can’t be removed from another causative factors that arise, one of the second cause from maternal mortality rates is preeclampsia, which is a specific disorder of hypertension caused by pregnancy at gestational age of more than 20 weeks with proteinuria and rarely occurs before 20 weeks gestational except if any kidney or trophoblastic disease. Hypertension and proteinuria to be a symptoms that often appears in preeclampsia diagnose. The relationship between of risk factor occur preeclampsia, that is blood pressure and protein urine which is the important indicator for enforcement of preeclampsia. The purpose of researchis analyze the relationship between of blood pressure and protein urine levels on the incidence of preeclampsia. The type of this research is analytic observational. Sample of this research is pregnant mother with preeclampsia in RSU Prima Husada Sidoarjo. The results use the Correlation Pearson test showed that p value for the systolic blood pressure is 0.791 and the diastolic blood pressure is 0.268, this is shows that blood pressure isn’t related with protein urine.

Page 1 of 1 | Total Record : 6

 1 

Filter by Year

2020 2020


Reset
Filter By Issues
All Issue Vol 6 No 1 (2023): July Vol 5 No 2 (2022): December Vol 5 No 1 (2022): July Vol 4 No 2 (2021): December Vol 4 No 1 (2021): July Vol 3 No 2 (2020): December Vol 3 No 1 (2020): July Vol 2 No 2 (2019): December Vol 2 No 1 (2019): July Vol 1 No 2 (2018): December Vol 1 No 1 (2018): July More Issue