Article Per Year (5 Year)
p-Index From 2019 - 2024
1.704
P-Index
This Author published in this journals
All Journal Jurnal Sain Veteriner Jurnal Veteriner Journal of Food and Life Sciences Journal of Innovation and Applied Technology Jurnal Ternak Tropika Jurnal Medik Veteriner Vitek : Bidang Kedokteran Hewan Jurnal Nutrisi Ternak Tropis (JNT)
Yudit Oktanella, Yudit
Fakultas Kedokteran Hewan Universitas Brawijaya
Agriculture, Biological Sciences & Forestry Biochemistry, Genetics & Molecular Biology Chemical Engineering, Chemistry & Bioengineering Computer Science & IT Immunology & microbiology Medicine & Pharmacology Public Health Veterinary

Published : 11 Documents Claim Missing Document
Claim Missing Document
Check
Articles

Found 11 Documents
Search

 1   2 
Supplementation of Casein Tablets of Goat Milk Yogurt on Dioxin-exposed Broiler Chickens Feed Consumption Wicaksono, Agung; Oktanella, Yudit; Widodo, Edwin
Journal of Food and Life Sciences Vol 5, No 1 (2021)
Publisher : University of Brawijaya

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.21776/ub.jfls.2021.005.01.02

Abstract

Combustion process in industry resulted in harmful free radical compounds such as Dioxin / TCDD (2,3,7,8- tetrachlorodibenzo-p-dioxin). The aim of the this experiment was to determine the therapeutic effect of casein in goat milk yogurt on chickens exposed to dioxins. Parameters used in this experiment were feed consumption and body weight. This research was designed with 18 male COBB strain broiler chickens aged 21 days. They were divided into three groups: (1) the negative group without any treatment, (2) the positive group by giving feed with dioxin 50ng / kg feed in corn oil solvent, (3) ) the therapy group was given feed with dioxin 50ng / kg feed in corn oil solvent in the morning and 750 mg / kg BW / day of yougurt casein goat milk in the afternoon. Both feed and casein were given orally for 21 days with each group having six replications. The samples were measured every day including weight gain and chicken feed consumption. The data were analyzed quantitatively using the One Way Analysis of Variance (ANOVA) test with a confidence level of 95%. The provision of goat milk yogurt casein tablets as a therapy for broiler chickens that were given dioxin-containing feed had a significant increase on chicken body weight, but insignificant on feed consumption.
Variasi Genetik Kambing Senduro dan Peranakan Etawa (PE) Berdasarkan Sekuen Gen CYT-B (Cytochrome-B) Dengan Metode Polymerase Chain Reaction Rizka Gitta Almaida; Yudit Oktanella; Gatot Ciptadi
TERNAK TROPIKA Journal of Tropical Animal Production Vol 21, No 2 (2020): TERNAK TROPIKA Journal of Tropical Animal Production
Publisher : Jurusan Produksi Ternak, Fakultas Peternakan, Universitas Brawijaya

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.21776/ub.jtapro.2020.021.02.3

Abstract

Informasi genetik kambing Senduro dan PE (Peranakan Etawa) yang berada di BBIB Singosari merupakan kambing lokal asal Jawa Timur, Indonesia yang digunakan dalam program breeding, khususnya untuk produksi semen beku untuk inseminasi buatan masih sangat terbatas. Perlu dilakukan analisa molekuler untuk menseleksi pejantan yang akan digunakan untuk produksi semen beku salah satunya dengan ilmu biologi molekuler. Penelitian tentang keragaman genetik dilakukan dengan menggunakan DNA mitokondria (mtDNA). Cytochrome b (Cyt-b) merupakan salah satu mtDNA yang memiliki laju mutasi yang sedang dan memiliki posisi sekuens nukleutida yang dipertahankan. Penelitian ini bertujuan untuk mengetahui susunan nukleutida kambing Senduro dan PE berdasarkan genotip mtDNA. Sampel yang digunakan berupa whole blood dari enam ekor kambing Senduro, dan tiga ekor kambing PE yang berasal dari BBIB Singosari, Malang, Jawa Timur. Sampel whole blood diisolasi dengan Blood DNA Preparation Kit by Jena Bioscience. Primer yang digunakan yaitu primer Forward (Cytb_F) 5’GCAATTGCCATAGTCCACCT’3 dan Reverse (Cytb_R) 5’GGATTTGCCGGG GTATAGTT’3. Hasil PCR disekuensing dengan metode Sanger. Analisa sekuen gen dilakukan menggunakan software MEGA-X. Penyejajaran pairwise distance menunjukkan terdapat perbedaan basa nukleutida pada kambing Senduro dan PE. Sampel SE1 mengalami missense mutation, dan sampel SE2, SE3, SE4, SE5, SE6, PE1, PE2, PE3 mengalami frameshift mutation. Hasil penelitian menunjukkan bahwa keragaman genetik kambing Senduro dan PE yang dibandingkan dengan database NCBI Capra hircus: D8420.1 tergolong tinggi.
Polimorfisme Gen Oviductal Glycoprotein-1 pada Oviduk Kambing Peranakan Etawa Penderita Kista Ovarium (OVIDUCTAL GLYCOPROTEIN-1 GENE POLYMORPHISM IN THE OVIDUCT OF ETTAWA CROSSBREED GOATS SUFFERING FROM OVARIAN CYST) Herawati Herawati; Febry Sysdityawan Ramadhan; Dyah Ayu Oktavianie; Yudit Oktanella
Jurnal Veteriner Vol 21 No 2 (2020)
Publisher : Faculty of Veterinary Medicine, Udayana University and Published in collaboration with the Indonesia Veterinarian Association

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (169.512 KB)

Abstract

Ovarian cysts are a disorder characterized by the growth of smooth muscle cells in the ovaries forming like fluid-filled balloons. Oviductal Glycoprotein (OVGP1) is secreted in the oviduct and plays a role in early embryonic development. The incidence of ovarian cysts is thought to affect the level of expression of the OVGP1 gene. The purpose of this study was to determine the potent role of OVGP1 gene as biomarker for detection of ovarian cyst on goats by Polymerase Chain Reaction (PCR) method. The samples used were DNA isolated from normal female PE goat oviduct and goat with follicular ovarian cyst obtained from RPH. The OVGP1 gene identification was performed by PCR method using 5'GACTGCAACCCACACAAGGA-3 forward primer (OVN1 _F) and reverse primer (OVN1_R) 5'GAGAGCAGCACCCACTTTTC-3 ‘. The sequencing of PCR results is done by Sanger method. The gene sequence analysis used the Bioedit and NCBI BLAST programs by comparing the PCR sequence on the follicular ovarian cyst and the normal ovary with the OVGP1 gene of the gene bank NM_001285584.1. The results showed that two normal samples and two samples of follicular cysts had similarities above 90% with OVGP1 gene bank NM_001285584.1. Samples with follicular ovarian cysts indicate a change in nucleotide base sequence due to deletions, insertions, transitions and transversions that affect the amino acid sequence. The arrangement of amino acids on samples with follicular ovarian cysts found an increase in the number of proline (P), threonine (T) and serine (S). In conclusion there is a difference in OVGP1 gene sequences in sample follicular ovarian cysts compared with sample normal ovaries . So the OVGP1 gene potentially can be used as a marker of follicular ovarian cysts.
Penambahan Osteopontin dalam Pengencer Semen Beku Sapi Perah Friesian Holstein Meningkatkan Ekspresi B-Cell Cll/Lymphoma-2 Spermatozoa Postthawing (ADDITIONAL OSTEOPONTIN INTO FROZEN FRIESIAN-HOLSTEIN SEMEN DILUTER INCREASES THE EXPRESSION OF B-CELL CLL/L Abdul Samik; Yudit Oktanella; Tatik Hernawati; Ngakan Made Rai Widjaja; Intan Purwa Dewanti
Jurnal Veteriner Vol 15 No 4 (2014)
Publisher : Faculty of Veterinary Medicine, Udayana University and Published in collaboration with the Indonesia Veterinarian Association

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (145.606 KB)

Abstract

Post thawed frozen semen viability is one of the most important keys in artificial inseminationdepended on two major cell death mechanism, apoptosis and necrosis. It has been known that good fertilitydiary bull’s seminal plasma contains high concentration of osteopontin (OPN). Osteopontin also known ascell survival protein via inhibition to apoptotic cell death, and B-cell CLL/Lymphoma-2 (Bcl-2)expressionmostly related to the ability of cell survival. The aim of this study was to investigate the influence ofadditional OPN into frozen semen diluter on post thawed sperm Bcl-2 expression. Fresh semen collectedfrom ±4 year Friesian Holstein bull. Treatment group divided into four groups i.e.: control group (P0:without OPN supplementation), (P1: fresh semen with OPN supplementation 5 ?g/5.107 spermatozoa), (P2:fresh semen with OPN supplementation 10 ?g/5.107 spermatozoa), (P3: fresh semen with OPNsupplementation 20 ?g/5.107spermatozoa). Bcl-2 sperm expression was determined usingimunocytochemistry. The result of this study showed that there was no significant difference betweengroup P0 and P1 (p>0,05), but both group P2 and group P3 showed a significant difference with P0 (p<0,05).Nevertheless, there was no significant difference between group P2to group P3 on post thawed FriesianHolstein sperm Bcl-2 expression (p>0,05). The conclusion of this study is osteopontin supplement in frozensemen diluter is capable to increase post thawed Friesian Holstein sperm Bcl-2 expression.
Optimalisasi Metode Pembudidayaan Manggot Black Soldier Fly di Desa Tambakasri Kecamatan Tajinan Yudit Oktanella; Raden Satrio Mukti; Arvel Risky Widyana; Zita Viera Pradnya R.; Ahmad Lukman Hadiprawoto
Journal of Innovation and Applied Technology Vol 7, No 2 (2021)
Publisher : Lembaga Penelitian dan Pengabdian Kepada Masyarakat Universitas Brawijaya

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.21776/ub.jiat.2021.006.02.9

Abstract

Ancaman peningkatan sampah organik berkontribusi terhadap perkembangan global warming dan penyebaran penyakit. Inovasi tentang pengelolaan sampah secara biokonversi merupakan metode alternatif sebagai upaya mengurangi pencemaran sampah organik dan disertai dengan manfaat lain yang dapat meningkatkan nilai ekonomi masyarakat. Larva Black Soldier Fly (maggot) dapat mengubah sampah organik menjadi protein dan lemak serta mengurangi massa sampah organik. Beberapa daerah mulai membudidayakan maggot dengan berbagai metode media fermentasi. Desa Tambakasri merupakan salah satu desa yang dapat membudidayakan maggot Black Soldier Fly dengan media fermentasi berupa ampas kelapa. Tujuan dari pengamatan ini adalah mengetahui lebih lanjut metode pembudidayaan maggot Black Soldier Fly di Desa Tambakasri. Berdasarkan pengamatan yang telah dilakukan ampas kelapa sebagai media fermentasi dapat mengurangi biaya operasional dengan penambahan serbuk kayu untuk mengurangi kelembaban. Hasil panen maggot dengan media tersebut dapat mencapai 30-60 kg maggot per petak dan dapat diolah menjadi produk turunan maggot.
KAJIAN ARTIKEL: POTENSI PLASMA NON TERMAL SEBAGAI KANDIDAT TERAPI MASTITIS SUBKLINIS Elfahra Casanza Amalda; Farah Alhamidah; Yudit Oktanella; Muhammad Khuzain
VITEK : Bidang Kedokteran Hewan Vol 10 (2020): VITEK - Bidang Kedokteran Hewan
Publisher : Fakultas Kedokteran Hewan Universitas Wijaya Kusuma Surabaya

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.30742/jv.v10i0.41

Abstract

Subclinical mastitis is the occurrence of inflammation in the parenchymal tissue of mammaryglands due to bacterial contamination that does not show clinical symptoms lead to impacted oneconomic losses. The highest incidence of subclinical mastitis is the presence of Staphylococcusaureus bacteria contamination. Subclinical mastitis in Indonesia is reported to reduce milk productionby up to 53.5%. Pathogenesis of Staphylococcus aureus occurs in the presence of biofilm formation asbacterial immune system to protecting itself from disinfectants and antibiotics. In the last few decades,the development of plasma technology has been widely used in the medical field as cancer therapy,reducing pain, accelerating wound healing and tissue sterilization. There is no study that using theconcept of utilizing Non Termal Plasma in the field of veterinary science, especially in mastitistherapy. Non Termal Plasma is able to decontaminate Staphylococcus aureus through inhibition anddestruction of biofilms. The mechanism of action of Non Termal Plasma in repairing mammary glandtissue is through the destruction of DNA in the Reactive Oxygen Species (ROS) process by increasingthe growth factor TGF-1 which accelerates the process normal cell regeneration. The objective ofthis study is to reviewing the efficacy of plasma non termal as subclinical mastitis theraphy. This studywas conducted through a narrative review approach by collecting international and nationalliterature with interval time of publication within 2010 – 2020.
Program Edukasi Perbaikan Pakan dan Pelayanan Inseminasi Buatan di Kelompok Ternak Sapi Perah Desa Medowo, Kecamatan Kandangan, Kota Kediri Viski Fitri Hendrawan; Desi Wulansari; Galuh Chandra Agustina; Yudit Oktanella; Aulia Firmawati
Jurnal Nutrisi Ternak Tropis Vol 3, No 2 (2020): JNT | Jurnal Nutrisi Ternak Tropis September 2020
Publisher : Jurnal Nutrisi Ternak Tropis

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.21776/ub.jnt.2020.003.02.7

Abstract

Tujuan kegiatan ini adalah untuk mengidentifikasi permasalahan peternak yang berkaitan dengan bidang pakan, reproduksi dan meningkatkan pengetahuan peternak dalam hal kesehatan ternak dan pentingnya management pelaksanaan Inseminasi Buatan (IB) yang baik sehingga tercapai efisiensi reproduksi. Kegiatan ini dilakukan mulai bulan Juni hingga Agustus 2020 yang terdiri atas kegiatan pemeriksaan kesehatan ternak, penyuluhan dan pelaksanaan IB serta kegiatan evaluasi. Hasil kegiatan menunjukkan bahwa sebanyak 20 (19%) dari 105 ekor sapi mengalami estrus, 20 (19%) ekor bunting, 4 (4,8%) kasus hipofungsi ovarium dan 9 (8,6%) kasus CLP yang didiagnosa dengan palpasi rektal sedangkan sisanya 51 ekor (48,6%) dalam kondisi tidak bunting (fase luteal dan dara). Sapi perah sebanyak 13 (65%) dari 20 ekor berhasil bunting setelah diinseminasi, sedangkan sisanya 7 ekor (35%) tidak bunting, hal ini disebabnya factor manajemen dan ketepatan pelaksanaan IB. Perbaikan reproduksi pada kasus hipofungsi dan CLP dapat diperbaiki dengan perbaikan pakan, pemberian vitamin A D E K dan perbaikan manajemen post partus, selain itu perlu juga dilakukan pengobatan hormonal. Kondisi sapi perah peternak anggota  KUD Kerta Jaya menunjukkan penampilan yang baik dilihat dari keberhasilan kebuntingan yang mencapai 65% setelah diberi perlakuan pakan, vitamin dan hormone serta secara umum tidak ada ternak yang mengalami gangguan reproduksi.
Upaya Peningkatan Produksi Susu Sapi Perah Dengan Pemberian Vitamin Ade dan Obat Cacing Galuh Chandra Agustina; Viski Fitri Hendrawan; Desi Wulansari; Yudit Oktanella
Jurnal Nutrisi Ternak Tropis Vol 3, No 1 (2020): JNT | Jurnal Nutrisi Ternak Tropis Maret 2020
Publisher : Jurnal Nutrisi Ternak Tropis

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.21776/ub.jnt.2020.003.01.1

Abstract

Saat ini produksi susu sapi dalam negeri baru bisa memasok tidak lebih dari 21% kebutuhan konsumsi susu, sisanya 79% berasal dari impor susu sapi. Keberhasilan beternak sapi perah untuk dapat meningkatkan produktivitas adalah kesehatan ternak. Gangguan kesehatan pada ternak dapat menyebabkan penurunan produktivitas sehingga menyebabkan kerugian ekonomi di bidang peternakan. Helminthiasis merupakan penyakit yang sangat sering terjadi pada ternak. Helminthiasis disebabkan oleh infeksi cacing dalam tubuh ternak. Lingkungan yang lembab dan sanitasi yang kurang baik, menjadi penyebab infeksi cacing. Telur-telur cacing akan mencemari pakan dan minum ternak, sehingga ikut tertelan ke dalam saluran pencernaan. Di dalam saluran pencernaan cacing menetas dan berkembang dengan mengambil nutrisi dari saluran pencernaan dengan cara merusak mukosa saluran pencernaan. Rusaknya mukosa saluran pencernaan mengakibatkan gangguan penyerapan nutrisi ternak. Pemberian obat cacing secara rutin perlu dilakukan untuk meningkatkan kesehatan dan produktivitas ternak. Obat cacing bekerja dengan cara membunuh atau mengurangi cacing dalam lumen usus dan atau jaringan tubuh.  Obat cacing yang digunakan adalah albendazole yang efektif untuk semua spesies cacing. Obat cacing diberikan secara per oral kepada pedet dan sapi dewasa yang tidak bunting sebanyak 97 ekor. Pemberian obat cacing dan vitamin memberikan dampak positif terhadap peningkatan produksi susu sapi sebanyak 12% dari 10 ekor sapi yang diambil secara sampling.
The Effect of Black Cumin (Nigella sativa) on Histopathology of Liver and Kidney in Albino Rats with Organophosphate Exposure Viski Fitri Hendrawan; Yudit Oktanella; Aulia Firmawati; Galuh Chandra Agustina
Jurnal Medik Veteriner Vol. 6 No. 1 (2023): April
Publisher : Faculty of Veterinary Medicine, Universitas Airlangga

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.20473/jmv.vol6.iss1.2023.35-42

Abstract

This study aimed to determine the effect of black cumin extract (Nigella sativa) on the histopathological of the liver and kidneys in albino rats exposed to organophosphates. This study used 20 male mice divided into five treatment groups, i.e. (K-) without organophosphate and black cumin, (K+) induced by organophosphate 40 mg/kg BW, treatment group induced by organophosphate 40 mg/kg BW and black cumin extract as therapy (P1 ) 200 mg/kg BW, (P2) 400 mg/kg BW, and (P3) 600 mg/kg BW. Organophosphate administration for eight weeks and black seed extract therapy was given for three weeks then the mice were euthanized, the liver and kidney organs were taken for histopathological observation using Haematoxylin-Eosin (HE). Data were analyzed using OneWay ANOVA test followed by Tukey test. The results showed that there were significant differences between the treatment groups for liver and kidney damage (p<0,05). Hepatic degeneration and necrosis in the P2 and P3 groups differed from K+ with an average of 2,24±0,9, in the kidneys with an average of 2,52±0,8. It can be concluded that black cumin extract has a significant effect on improving the liver and kidneys in groups P3 (600 mg/kgBW).
Analisis Pemberian Serbuk Jahe Merah, Kunyit, dan Temulawak Dengan Metode Insilico dan Invivo pada Ayam Broiler Herawati .; Renanda Nur Al Jabbar; Yudit Oktanella
Jurnal Sain Veteriner Vol 41, No 1 (2023): April
Publisher : Fakultas Kedokteran Hewan Universitas Gadjah Mada bekerjasama dengan PB PDHI

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.22146/jsv.76111

Abstract

This study aimed to eveluate effect of combination powder of red ginger (Zingiber officinale var. Rubrum), turmeric (Curcuma domestica), and temulawak (Curcuma xanthorrhiza) on the calculation of normal Liberkhun crypts by insilico and invivo methods. Molecular docking conducted in the pocket site of Interferon Lambda Receptor (IFN-λR) to modulate anti-inflammatory activity in chicken caecum. The study used 20 day old chickens (DOC) which were randomly grouped into 5 groups: negative control without treatment (P0) and powder addition group {0,5% (P1); 1%(P2); 1.5%(P3); 2%(P4)}. All chickens were reared for 35 days then chickens were euthanized using halal slaughter method and caecum organs were collected  for histopathological observations. all active substances red ginger (gingerol, shogaol); turmeric (curcumin,tetrahydrocurcumin); and temulawak (demethoxycurcumin, bisdemethoxycurcumin) can bind to IFN-λR. Curcumin (-6.0 kcal/mol) have highest affinity values. Invivo treatment showed significant effect (p<0.05) on normal calculation of Liberkhun crypts due to tissue damage. Tukey's test confirmed that negative group was significantly different from P2, P3, and P4 with an average (4.35 ± 1.09b; 5.6 ± 1.54c; and 5.7 ± 1.78c). This research suggests that the addition of combination powder by 1,5% can potentially used for anti-inflamatory agent that confirmed by insilico method.
Co-Authors Abdul Samik Ageng Ilham Ramadhani Agung Wicaksono Ahmad Lukman Hadiprawoto Arvel Risky Widyana Desi Wulansari Desi Wulansari Dyah Ayu Oktavianie Edwin Widodo Elfahra Casanza Amalda Farah Alhamidah Febry Sysdityawan Ramadhan Firmawati, Aulia Galuh Chandra Agustina Galuh Chandra Agustina Galuh Chandra Agustina Gatot Ciptadi Hardian, Andreas Bandang Herawati . Herawati Herawati Intan Purwa Dewanti Muhammad Khuzain Ngakan Made Rai Widjaja Raden Satrio Mukti Renanda Nur Al Jabbar Rizka Gitta Almaida Tatik Hernawati Tatik Hernawati Viski Fitri Hendrawan Wawid Purwatiningsih Zita Viera Pradnya R.