Article Per Year (5 Year)
p-Index From 2019 - 2024
0.408
P-Index
This Author published in this journals
All Journal Research Journal of Life Science Journal of Tropical Plant Protection
Abdul Latief Abadi
Department of Plant Pests and Diseases, Faculty of Agriculture, University of Brawijaya
Agriculture, Biological Sciences & Forestry Education

Published : 2 Documents Claim Missing Document
Claim Missing Document
Check
Articles

Found 2 Documents
Search

 1 
Potential of Indigenous Yeast as a Paraquat Biodegradation Agent in Sumberbrantas, Batu City, Indonesia Mohammed Bosha; Abdul Latief Abadi; Luqman Qurata Aini
Journal of Tropical Plant Protection Vol. 3 No. 1 (2022)
Publisher : University of Brawijaya

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.21776/ub.jtpp.2022.003.1.1

Abstract

Herbicides are a substance or chemical compound used to inhibit growth or kill plants. Herbicides are toxic to weeds or pests as well as cultivated plants. The impact of using the herbicide paraquat causes some microbes to become more resistant and has the potential to be used as a paraquat biodegradation agent. Indigenous yeast is one of the microbes that can be used as a biodegradation agent because it is resistant to the environment. For this reason, This research aimed to investigate the indigenous yeast isolated from the potato field in Sumberbrantas village, Batu City as a bioremediation agent for paraquat herbicide residues.The sampling was carried out in the potato field of Sumberbrantas, Batu City, which in routine maintenance uses a herbicide with active paraquat (1,1 dimethyl -4, 4-bipyridinium dichloride).The isolation results obtained 6 isolates of indigenous yeast which had the potential as biodegradation agents for paraquat. Treatment of yeast isolates MB 1, MB 3, MB 4, MB 6, MB 7, MB 8 at concentrations of 250, 500, 1,000 and 2,000 paraquat were able to survive with a growth percentage of 75-100%. At a concentration of 5,000 Isolated yeast decreased with a growth percentage of 50-75% and MB 1 isolate with 10,000 ppm concentration still survive with a growth percentage of 1-25%. The highest biodegradability ability of yeast was in MB 1. The identification of MB 1 isolates based on molecular characters have similarities in the basic structure of 98.89% with Geotrichum silvicola UFMG 354-228S isolates with accession number NG_0606221.1.
Characterization of Ralstonia solanacearum Using Fourier Transform Infrared (FTIR) Spectroscopy Nur Ma'alifah; Luqman Qurata Aini; Abdul Latief Abadi; Kestrilia Rega Prillianti; Matheus Randy Prabowo
Research Journal of Life Science Vol 9, No 2 (2022): : IN PRESS
Publisher : Lembaga Penelitian dan Pengabdian kepada Masyarakat, Universitas Brawijaya

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.21776/ub.rjls.2022.009.02.2

Abstract

Ralstonia solanacearum, the causal agent of bacterial wilt disease is worldwide in distribution, and results in serious economic losses, particularly in the tropics. Detection and characterization of microorganisms by Fourier transform infrared spectroscopy (FTIR) technique promises to be of great value because of the method’s inherent sensitivity, small sample size, rapidity, and simplicity. In this study, we used FTIR spectroscopy for the characterization of Ralstonia solanacearum. The bacteria were grown on Nutrient Agar (NA) at 28°C for 48 hours. The colonies of Ralstonia solanacearum on nutrient agar medium were smooth circular, raised, and dirty white. Cultures of bacteria were identified by molecular methods using PCR techniques. The DNA was amplified using a specific primer pair, 759f/760r (forward primer: 5'- GTCGCCGTCAACTCACTTTCC 3’, reverse primer: 5'-GTCGCCGTAGCAATGCGGAATCG-3’). The PCR produced a single band of 280 bp from the isolated DNA of cultured bacteria.  Bacterial spectra were obtained in the wavenumber range of 4000–400 cm-1 using FTIR spectroscopy. The identification of cell wall constituents in region 3000–2800 cm-1, the proteinaceous structure of bacteria in region 1665–1200 cm-1, and the fingerprint of bacteria in region 1200-800 cm-1 are all part of the spectra analysis in this study. Absorption bands obtained from bacteria Ralstonia solanacearum samples associated with protein, phospholipids, nucleic acids, and carbohydrates appear in the bacterial IR absorption spectra.
Co-Authors Kestrilia Rega Prilianti Luqman Qurata Aini Matheus Randy Prabowo Mohammed Bosha Nur Ma'alifah