Article Per Year (5 Year)
p-Index From 2019 - 2024
0.61
P-Index
This Author published in this journals
All Journal Research Journal of Life Science Journal of Tropical Plant Protection
Luqman Qurata Aini
Department of Plant Pests and Diseases, Faculty of Agriculture, University of Brawijaya
Agriculture, Biological Sciences & Forestry Education

Published : 5 Documents Claim Missing Document
Claim Missing Document
Check
Articles

Found 5 Documents
Search

 1 
The Application of Beauveria bassiana and Lufenuron Could Reduce the Reproduction of Fruit Fly (Bactrocera carambolae) (Drew dan Hancock) (DIPTERA: TEPHRITIDAE) Mochammad Syamsul Hadi; Toto Himawan; Luqman Qurata Aini
Journal of Tropical Plant Protection Vol 1, No 1 (2012)
Publisher : University of Brawijaya

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (263.609 KB)

Abstract

AbstractThis study was conducted to examine the effect of Beauveria bassiana and insect growth regulator lufenuron on the fecundity and reproductivity decline of fruit fly B. carambolae adults. The study was conducted at the Laboratory of Entomology, Department of Plant Pests and Diseases, Facultyof Agriculture, University of Brawijaya from March 2012 until December 2012. The density of B. bassiana spores used in this study was 108 spores/ml and the lufenuron concentrations used are 0.5, 1, and 1.5 ml/l. The results showed that the application of B. bassiana spores at density of 108 spores/ml combined with lufenuron at the concentration of 1.5 ml/l significantly reduced the fecundity, egg fertility and reproduction of B. carambolae up to 95.69%.Keywords: Beauveria bassiana, Bactrocera carambolae, Lufenuron.
The effect of PGPR (Plant Growth Promoting Rhizobacteria) Pseudomonas fluorescens and Bacillus subtilis On Leaf Mustard Plant (Brassica juncea L.) Infected by TuMV (Turnip Mosaic Virus) Bogi Diyansah; Luqman Qurata Aini; Tutung Hadiastono
Journal of Tropical Plant Protection Vol 1, No 1 (2012)
Publisher : University of Brawijaya

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (295.861 KB)

Abstract

AbstractOne problem that causing leaf mustard yield loss is the infection of Turnip Mosaic Virus (TuMV). Thevirus causes mild mosaic leaf with vein clearing, blister, malformation and stunting. The use of Plant Growth Promoting Rhizobacteria (PGPR) such as Pseudomonas fluorescens and Bacillus subtilis is oneeffort that could be used to solve the problem. Through the mechanism of induced resistance, thesebacteria can elicit the defense signal in plant for the defence against pathogens. In this study the use of Pseudomonas fluorescens and Bacillus subtilis was performed to test their benefit on leaf mustard planthealth against TuMV infection. This study was conducted with a randomized block design (RBD) byusing 8 treatments and 4 replications. On the experiment of the effect of PGPR on the root length ofleaf mustard plants, the design used was a completely randomized design (CRD) with 4 treatments and4 replications. Leaf mustard plants inoculated with Pseudomonas fluorescens and Bacillus subtilis hadlonger roots than those without the inoculation of Pseudomonas fluorescens and Bacillus subtilis. Inaddition, Pseudomonas fluorescens and Bacillus subtilis was also able to reduce the incubation periodand disease intensity of TuMV on the leaf mustard plant. The activity of catalase enzyme and phenolcontent was elevated in the leaf of leaf mustard plant inoculated with PGPR. The results suggested thatcatalase and phenol production probably play a role in plant defense of leaf mustard against theinfection of TuMV.Key word : Mustard, Turnip Mosaic Virus (TuMV), PGPR
Virulency of Bacillus subtilis and Trichoderma harzianum Against Sprout Disease Pythium spp. in Cucumber Plants Minal Maimanah; Restu Rizkyta Kusuma; Luqman Qurata Aini
Journal of Tropical Plant Protection Vol. 2 No. 2 (2021)
Publisher : University of Brawijaya

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.21776/ub.jtpp.2021.002.2.1

Abstract

Sprout disease (damping off) is one of the important diseases that attack a variety of horticultural plants. Besides, sprouts disease can also attack seeds that have not germinated (preemergence damping-off). This study aimed to determine and compare the ability of B. subtilis and T. harzianum in controlling the pathogen Pythium spp. in cucumber plants. Phy01CK and Phy01IP isolates were use in the virulency test and inoculation methods of pathogens. The inhibition test between B. subtilis and T. harzianum against Pythium spp. was conducted in the in vitro test. This research was used a randomized block design with 13 treatments and three replications. The results of the antagonist's effect in vitro between T. harzianum and Pythium spp. showed the highest suppressing growth of Pythium spp. which is 70%. B. subtilis, B. subtilis + T. harzianum and fungicides each having a zone of inhibition of 23%, 32% and 46%. In the in vivo tests, the application of biological agents with 3 different times was not affecting the incidence of damping-off disease at 10 days after planting.
Potential of Indigenous Yeast as a Paraquat Biodegradation Agent in Sumberbrantas, Batu City, Indonesia Mohammed Bosha; Abdul Latief Abadi; Luqman Qurata Aini
Journal of Tropical Plant Protection Vol. 3 No. 1 (2022)
Publisher : University of Brawijaya

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.21776/ub.jtpp.2022.003.1.1

Abstract

Herbicides are a substance or chemical compound used to inhibit growth or kill plants. Herbicides are toxic to weeds or pests as well as cultivated plants. The impact of using the herbicide paraquat causes some microbes to become more resistant and has the potential to be used as a paraquat biodegradation agent. Indigenous yeast is one of the microbes that can be used as a biodegradation agent because it is resistant to the environment. For this reason, This research aimed to investigate the indigenous yeast isolated from the potato field in Sumberbrantas village, Batu City as a bioremediation agent for paraquat herbicide residues.The sampling was carried out in the potato field of Sumberbrantas, Batu City, which in routine maintenance uses a herbicide with active paraquat (1,1 dimethyl -4, 4-bipyridinium dichloride).The isolation results obtained 6 isolates of indigenous yeast which had the potential as biodegradation agents for paraquat. Treatment of yeast isolates MB 1, MB 3, MB 4, MB 6, MB 7, MB 8 at concentrations of 250, 500, 1,000 and 2,000 paraquat were able to survive with a growth percentage of 75-100%. At a concentration of 5,000 Isolated yeast decreased with a growth percentage of 50-75% and MB 1 isolate with 10,000 ppm concentration still survive with a growth percentage of 1-25%. The highest biodegradability ability of yeast was in MB 1. The identification of MB 1 isolates based on molecular characters have similarities in the basic structure of 98.89% with Geotrichum silvicola UFMG 354-228S isolates with accession number NG_0606221.1.
Characterization of Ralstonia solanacearum Using Fourier Transform Infrared (FTIR) Spectroscopy Nur Ma'alifah; Luqman Qurata Aini; Abdul Latief Abadi; Kestrilia Rega Prillianti; Matheus Randy Prabowo
Research Journal of Life Science Vol 9, No 2 (2022): : IN PRESS
Publisher : Lembaga Penelitian dan Pengabdian kepada Masyarakat, Universitas Brawijaya

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.21776/ub.rjls.2022.009.02.2

Abstract

Ralstonia solanacearum, the causal agent of bacterial wilt disease is worldwide in distribution, and results in serious economic losses, particularly in the tropics. Detection and characterization of microorganisms by Fourier transform infrared spectroscopy (FTIR) technique promises to be of great value because of the method’s inherent sensitivity, small sample size, rapidity, and simplicity. In this study, we used FTIR spectroscopy for the characterization of Ralstonia solanacearum. The bacteria were grown on Nutrient Agar (NA) at 28°C for 48 hours. The colonies of Ralstonia solanacearum on nutrient agar medium were smooth circular, raised, and dirty white. Cultures of bacteria were identified by molecular methods using PCR techniques. The DNA was amplified using a specific primer pair, 759f/760r (forward primer: 5'- GTCGCCGTCAACTCACTTTCC 3’, reverse primer: 5'-GTCGCCGTAGCAATGCGGAATCG-3’). The PCR produced a single band of 280 bp from the isolated DNA of cultured bacteria.  Bacterial spectra were obtained in the wavenumber range of 4000–400 cm-1 using FTIR spectroscopy. The identification of cell wall constituents in region 3000–2800 cm-1, the proteinaceous structure of bacteria in region 1665–1200 cm-1, and the fingerprint of bacteria in region 1200-800 cm-1 are all part of the spectra analysis in this study. Absorption bands obtained from bacteria Ralstonia solanacearum samples associated with protein, phospholipids, nucleic acids, and carbohydrates appear in the bacterial IR absorption spectra.
Co-Authors Abdul Latief Abadi Bogi Diyansah Kestrilia Rega Prilianti Kusuma, Restu Rizkyta Matheus Randy Prabowo Minal Maimanah Mochammad Syamsul Hadi Mohammed Bosha Nur Ma'alifah Toto Himawan Tutung Hadiastono