Claim Missing Document
Check
Articles

Found 5 Documents
Search

Histopatologi Limpa dan Limfonodus pada Kasus Lapangan dengan Dugaan Kematian Akibat Virus African Swine Fever Pada Babi di Kabupaten Kupang Gelolodo, Maria Aega; Sanam, Maxs U. E.; Toha, Larry R. W.; Widi, Antin Y. N.; Simarmata, Yohanes T. R. M. R.; Murni, Theresia F. I. M. D.
JURNAL KAJIAN VETERINER Vol 9 No 2 (2021): Jurnal Kajian Veteriner
Publisher : FAKULTAS KEDOKTERAN HEWAN UNIVERSITAS NUSA CENDANA

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.35508/jkv.v9i2.4090

Abstract

African swine fever is a fatal hemorrhagic disease in the Suidae family that has become a significant economic challenge to the global pig farming industry. The continued spread of this disease has threatened global pork production and food security. Recognizing the disease manifestations and pathological changes of ASF is critical for a comprehensive and accurate early warning program. Knowledge of the key characteristics of this disease, such as its pathology anatomy, and histopathology, is also needed for early identification of ASF before establishing a tentative diagnosis. This article aims to discuss the pathologic changes and to update disease understanding in order to improve early detection of ASF in the field. A histopathological study of clinical samples collected during the February to April 2021 outbreak of ASF was performed to determine the characteristic lesions of ASF. Three dead ASFV-suspected pigs from a farm in Kupang regency were examined in this study. The main characteristics at the gross pathology inspection were hemorrhage and enlargement of the spleens and lymph nodes. The histopathologic findings confirmed spleen and lymph nodes hemorrhages, as well as congestion of spleen and follicle necrotic at the lymph nodes. Based on the clinical manifestation, pathological findings, and epidemiology observation, it is suspected that the pigs were infected with ASF. However, a molecular diagnostic test should be taken to confirm the definitive cause of the pig’s deaths.
GROSS PATHOLOGICAL FINDINGS OF AFRICAN SWINE FEVER SUSPECTS IN OEBELO, KUPANG REGENCY, 2021 Sanam, Maxs U. E.; Gelolodo, Maria Aega; Toha, Larry R. W.; Utami, Tri; Simarmata, Yohanes T. R. M. R.; Murni, Theresia F. I. M. D.
JURNAL KAJIAN VETERINER Vol 9 No 3 (2021): Jurnal Kajian Veteriner
Publisher : FAKULTAS KEDOKTERAN HEWAN UNIVERSITAS NUSA CENDANA

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.35508/jkv.v9i3.7869

Abstract

African swine fever (ASF) is a destructive re-emerging swine disease that has posed a serious economic threat to the global pig farming sector. In past years, ASF has rapidly spread over Europe, Asia, and Oceania, and begin to enter Indonesia in the middle of 2019. The clinical and pathological symptoms of ASF are influenced by the strain's virulence, the transmission pathway, and the pig's immunological and health status. ASF’s clinical manifestations are known to evolve, from after an invasion enters a new free region to after the disease has been established in the territory for a longer period. Identifying ASF clinical signs and pathological changes is crucial for a comprehensive and reliable early detection system. The objective of this research is to observe and identify gross pathology in ASF suspect pigs in order to obtain a better understanding of the cause of death. Two dead pigs from a farm in Oebelo village, Kupang regency, Indonesia with a recent history of massive deaths had been examined in this study. The post-mortem results showed that hemorrhagic splenomegaly and hemorrhagic lymphadenitis were the main lesions observed at the examinations. Furthermore, hemorrhages were also found in various internal organs such as the kidneys, liver, and heart. To determine the exact cause of the pigs' deaths, a molecular diagnostic test should be conducted.
Analisis Nukleotida dan Homologi Sekuens Fragmen Gen p72 (B646L) Virus African Swine Fever Virus (ASF) Asal Kota Kupang Sanam, Maxs U. E.; Gelolodo, Maria Aega; Toha, Larry R. W.
JURNAL KAJIAN VETERINER Vol 10 No 2 (2022): Jurnal Kajian Veteriner
Publisher : FAKULTAS KEDOKTERAN HEWAN UNIVERSITAS NUSA CENDANA

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.35508/jkv.v10i2.7875

Abstract

African Swine Fever (ASF) is an important infectious disease in pigs caused by African Swine Fever Virus (ASFV). Despite not being zoonotic, this disease has the potential to severely affect the socioeconomic conditions in the impacted regions. The majority of pig farmers in Indonesia, particularly those in Kupang City, that raise pigs in backyards or on a small scale, experience the impact of ASF's effects. Early in 2020, the ASF cases were confirmed in Timor Island, including the Kupang City area in Nusa Tenggara Timur (NTT) Province. The molecular information on ASFV in this area is still limited. In order to determine the homology and nucleotide analysis using BLAST NCBI, the ASFV p72 (B646L) gene fragment sequence from Kupang City was compared to ASFV p72 (B646L) gene segments from other parts of Indonesia and several other Asian countries. The results of nucleotide analysis and sequence homology of the original ASFV p72 (B646L) gene fragment from Kupang City showed a high level of homology to the ASFV p72 (B646L) gene fragment from West Java, North Sumatra, and several Asian countries. The findings from this study indicate that the source of ASF viral transmission across different regions may be comparable. Therefore, to prevent the dissemination of ASF, strict biosecurity measures must be implemented along with monitoring of animal and product transportation.
Struktur Populasi Ternak Sapi Bali di Pulau Semau Arifandi, Firgilius; Toha, Larry R. W.; Kallau, Novalino H. G.; Winarso, Aji
JURNAL KAJIAN VETERINER Vol 12 No 1 (2024): Jurnal Kajian Veteriner
Publisher : FAKULTAS KEDOKTERAN HEWAN UNIVERSITAS NUSA CENDANA

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.35508/jkv.v12i1.8646

Abstract

Semau Island is an island across the west of the island of Timor which is an area of ​​Kupang Regency with the potential for developing Bali cattle. This study aims to determine the population structure of Bali cattle in Semau Island. This research uses simple random sampling method. Collecting data in the form of primary data (interviews/questionnaires) and secondary data. The total sample used is 110 farmers. The parameters measured in the population structure are livestock birth rates, livestock purchases, livestock mortality, livestock slaughter, livestock sales, livestock income, livestock expenditure, and natural increase values. The results showed that the population structure of Bali cattle on Semau Island which was owned by the respondents was dominated by 455 female cows with a total of 1103 cows. Birth rate of 16.59%, purchase rate of 4.26%, death rate of 4.17%, slaughter rate of 0.18%, sales rate of 10.06%, income rate of 20.85%, expenditure rate of 14.42%, and the Natural Increase (NI) value of 12.42%.
Development of Highly Sensitive Conventional PCR for African Swine Fever Virus Diagnosis in East Nusa Tenggara (NTT) Province Pandarangga, Putri; Ticoalu, Abigail E.; Gelolodo, Maria A. E. G. A; Toha, Larry R. W.
JURNAL KAJIAN VETERINER Vol 11 No 2 (2023): Jurnal Kajian Veteriner
Publisher : FAKULTAS KEDOKTERAN HEWAN UNIVERSITAS NUSA CENDANA

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.35508/jkv.v11i2.13118

Abstract

African Swine Fever (ASF) adalah penyakit menular pada babi dengan tingkat mortalitas mencapai 100%. Pada tahun 2019, penyakit ini sebabkan wabah pada provinsi Nusa Tenggara Timur (NTT), dimana merupakan provinsi penghasil babi terbesar di Indonesia. PCR masih digunakan sebagai alat diagnosa untuk deteksi ASF virus (ASFV). Lepas dari sensitifitas dan spesifitasnya mencapai 90%, hasil dari PCR untuk mendeteksi ASGV masih memberikan false negatives pada beberapa laboratorium. Sehingga, tujuan dari penelitian ini adalah untuk mengembangkan PCR yang sangat sensitif untuk deteksi ASFV secara akurat di NTT. Metode penelitian dimulai dengan penentuan tipe dari sampel, primers setup, ekstraksi DNA, pencampuran master mix, proses amplifikasi, dan elektroforesis. Hasil PCR menunjukkan bahwa ASFV dideteksi pada hati, ginjal, dan limpa dari babi yang mati di Kabupaten Kupang, NTT dengan menggunakan primer : 5' CGCAGAGGTAAGCTTTCAGG 3' (forward primer) dan 5' GCCGATACCACAAGATCAGC 3' (reverse primer) dari gen p72. Panjang produk PCR mencapai 372 bp. Sehingga, hasil studi ini dapat diaplikasikan sebagai referensi bagi laboratorium di NTT dalam mendiagnosa ASF sehingga penyakit tidak menyebar dengan cepat dan menyebabkan wabah berikutnya.