Garuda - Garba Rujukan Digital

Barcode DNA berdasarkan Gen rbcL dan matK Anggrek Payus Limondok (Phaius tancarvilleae) (DNA Barcode of Payus Limondok Orchid (Phaius tancarvilleae) Based on the rbcL and matK genes) Kolondam, Beivy J; Lengkong, Edy; J. Polii, Mandang; Pinaria, Arthur; Runtunuwu, Semuel
JURNAL BIOS LOGOS Vol 2, No 2 (2012): JURNAL BIOSLOGOS
Publisher : Universitas Sam Ratulangi

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.35799/jbl.2.2.2012.1041

Metode identifikasi spesies telah disepakati menggunakan barcode DNA standar yaitu gen rbcL dan gen matK. Tujuan penelitian ini untuk menentukan tingkat kemiripan sekuens barcode DNA tanaman Anggrek Payus Limondok (Phaius tancarvilleae) dengan spesies kerabatnya yang sudah terdata dalam BOLD Systems, merekomendasi penggunaan barcode untuk mengidentifikasi atau mengkonfirmasi spesies ini, dan mengamati variasi intraspesifik. Teknik Polymerase Chain Reaction (PCR) digunakan untuk mengamplifikasi sekuens gen rbcL dan matK melalui primer universal. Barcode rbcL menunjukkan kemiripan 100% (identik) dengan dua spesies berbeda dalam famili yang sama (Orchidaceae), sehingga tidak bisa diandalkan untuk identifikasi spesies P. tancarvilleae secara akurat. Sekuens matK sampel menghasilkan kemiripan 100% dengan spesies sama yang sebelumnya telah terdata dalam BOLD Systems. Kemiripan ini mengindikasikan rendahnya variasi genetik intraspesies tetapi sekuens matK dapat diandalkan untuk identifikasi atau konfirmasi spesies anggrek P. tancarvilleae.Kata Kunci: barcode, rbcL, matK, Phaius tancarvilleaeÂ AbstractSpecies identification methods convention have been recommended to use standard DNA barcode for plants; the rbcL and matK genes. The aims of this research were to determine similarities in barcode DNA sequences of Payus Limondok Orchid (Phaius tancarvilleae) with its close relatives that listed in BOLD Systems, to recommend the use of DNA barcodes for identification or confirmation of this species, and to observe intraspecific variations. Polymerase Chain Reaction technique was employed to amplify rbcL and matK genes using universal primers. The rbcL barcode of Payus Limondok resulted identical hit with other two different species in the same family (Orchidaceae), therefore, unreliable for accurate P. tancarvilleae species identification. The matK sequence of this plant was 100% similar with the same plant species listed in BOLD Systems. This similarity indicated low genetic variation within the species, but the matK sequence was found to be reliable for P. tancarvilleae orchid species identification or confirmation.Keywords: barcode, rbcL, matK, Phaius tancarvilleae

Barcode DNA Anthurium Gelombang Cinta (Anthurium plowmanii) berdasarkan gen rbcL dan matK (The DNA Barcode of Anthurium Wave of Love (Anthurium plowmanii) based on rbcL and matK Genes) Kolondam, Beivy J; Lengkong, Edy; Polii-Mandang, J; Semuel, Runtunuwu; Pinaria, Arthur
JURNAL BIOS LOGOS Vol 3, No 1 (2013): JURNAL BIOSLOGOS
Publisher : Universitas Sam Ratulangi

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.35799/jbl.3.1.2013.3385

AbstrakMetode standar untuk identifikasi spesies tumbuhan melalui barcode DNA telah direkomendasikan untuk menggunakan dua gen plastida yaitu rbcL dan matK. Tujuan penelitian ini yaitu untuk menentukan tingkat kemiripan sekuens barcode DNA tanaman Anthurium Gelombang Cinta (Anthurium plowmanii) dibandingkan spesies kerabatnya yang sudah terdata dalam BOLD Systems dan untuk merekomendasi penggunaan barcode DNA yang bisa diandalkan dalam mengidentifikasi spesies ini. Teknik Polymerase Chain Reaction (PCR) digunakan dalam perbanyakan sekuens fragmen gen rbcL dan gen matK oleh primer universal yang tersedia. Hasil penelitian menyimpulkan bahwa sampel tanaman A. plowmanii menghasilkan sekuens barcode rbcL yang mirip 100% (identik) dengan spesies A. cubense. Ini berarti barcode DNA rbcL tidak dapat digunakan untuk identifikasi tingkat spesies. Sekuens barcode matK sampel menunjukkan kemiripan 99,1% dengan A. ravenii yang berbeda dalam morfologi daun. Sekuens matK sampel bersifat unik diantara anggota-anggota genus Anthurium sehingga direkomendasikam penggunaannya untuk identifikasi sampai tingkat spesies.Kata Kunci: barcode, rbcL, matK, Anthurium plowmaniiAbstractStandard method for plant species identification through DNA barcode has been recommended to use two plastids genes; the rbcL and matK. The aims of this research were to determine similarities in DNA barcode sequences of Anthurium Wave of Love (Anthurium plowmanii) with its close relatives that listed in BOLD Systems and to recommend the reliable DNA barcode for identification of this species. Polymerase Chain Reaction was employed to amplify rbcL and matK genes fragments using available universal primers. The result showed that A. plowmanii sample was 100% similar to A. cubense. For that reason, the rbcL gene is not a reliable for species identification. Sequence of matK barcode showed 99.1% in similarity with A. ravenii which has different leaf shape. The matK sequence of sample was unique among all listed Anthurium members, therefore, this barcode are recommended for plant identification to the species level.Keywords: barcode, rbcL, matK, Anthurium plowmanii

DNA Barcoding Tanaman Daluga (Cyrtosperma spp) dari Kepulauan Sangihe Berdasarkan Gen matK (DNA Barcoding Daluga Plant (Cyrtosperma spp) of Sangihe Island Based on matK Gene) Julianti, Eka; Pinaria, Arthur; Lengkong, Edy F; Kolondam, Beivy J
JURNAL BIOS LOGOS Vol 5, No 2 (2015): JURNAL BIOSLOGOS
Publisher : Universitas Sam Ratulangi

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.35799/jbl.5.2.2015.10547

AbstrakÂ Tanaman daluga (Cyrtosperma spp.) termasuk dalam famili Araceae (talas-talasan), umbinya berpotensi sebagai tanaman pangan alternatif karena mempunyai nilai gizi yang tinggi. Tanaman ini banyak terdapat di Kepulauan Sangihe. Penelitian ini dilakukan untuk mengetahui DNA barcoding daluga hijau, kuning dan belang-belang dengan menggunakan gen matK (maturase K). Ekstraksi DNA menggunakan Genomic DNA Mini Kit Plant (Geneaid), amplifikasi DNA menggunakan Kit PCR 5x FirePol Master Mix (Solis Biodyne) dan sepasang primer universal yaitu matK-3F-r (5â€™CGTACAGTACTTTTGTGTTTACGAG 3â€™) dan matK-1R-f (5â€™ACC CAGTCCATCTGGAAATCTTGGTTC3â€™). Hasil penelitian menunjukkan bahwa tanaman daluga hijau, daluga kuning, dan daluga belang-belang dari Kepulauan Sangihe memiliki sekuens DNA yang identik (kemiripan 100%). Daluga yang diteliti memiliki kemiripan sekuens dengan sampel di NCBI yaitu dengan Cyrtosperma macrotum (99,88%), Podolasia stipitata (99,50%), Dracontium polyphyllum (99,38 %), Pycnospatha arietina (99,38%) dan Dracontioides desciscen (99%). Dari hasil penelitian ini dapat disimpulkan bahwa DNA barcoding tanaman daluga dari kepulauan Sangihe berdasarkan gen matK belum dapat membedakan variasi intraspesies. Kata kunci: daluga, dalugha, Cyrtosperma spp.Â AbstractÂ Daluga (Cyrtosperma spp.) plant belongs to the family Araceae, the corm is potential as an alternative food because it has a high nutritional value. The plant is widely available in Sangihe Island. This study aimed to determine the DNA barcoding of green daluga, yellow daluga and mottled daluga using matK gene (maturase K). The DNA extraction used Genomic DNA Mini Kit Plant (Geneaid) and DNA amplification used the Kit PCR 5x FirePol Master Mix (Solis Biodyne) and universal primers matK-3F-R (5' CGTACAGTACTT TTGTGTTTACGAG 3') and matK-1R-f (5'ACCCAGAAATGGATCTCTTCCTGG TTC3'). The result showed that the green daluga, yellow daluga and mottled daluga from Sangihe Islands were identical (100% similarity). Daluga from Sangihe had similarities with the sample sequences in NCBI, namely Cyrtosperma macrotum (99.88%), Podolasia stipitata (99.50%), Dracontium polyphyllum (99,38%) Pycnospatha arietina (99.38%) and Dracontioides desciscen (99%). From these results it could be concluded that DNA barcoding of daluga plant from Sangihe based on the matK gene could not Â distinguish variations intraspesies. Keywords: daluga, dalugha, Cyrtosperma spp.

Plant Morphology and Analysis of Yellow Temulawak Curcumin (Curcuma xanthorrhiza Roxb.) In the Kinilow Village Meilani Elseday Ma'tan; Arthur G. Pinaria; James B. Kaligis; Jackson F. Watung; Frangky J. Paat; Diane D. Pioh
Jurnal Agroekoteknologi Terapan Vol. 3 No. 2 (2022): EDISI JULI-DESEMBER 2022
Publisher : Sam Ratulangi University

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.35791/jat.v3i2.44871

Temulawak or Curcuma xanthorrhiza Roxb is a very famous plant in Indonesia, even in the world. Temulawak is a plant that is often used as medicine and can be found in tropical forests. The purpose of this study was to determine the morphology of the yellow temulawak plant and to analyze the content of the curcumin compound found in the yellow temulawak. This study used TLC-Densitometry. The sample used was yellow curcuma found in Kinilow Village, Tomohon City, North Sulawesi Province. For morphological observations, only one plant was used as the object of observation. Based on the results of the study it can be concluded that the morphology of yellow temulawak has a plant height of 1.29 m, stem height of 79 cm, leaf length of 71 cm, leaf width of 26 cm. Curcuma is white, purple and light green. flowers, root length 13 cm, and rhizome weight 250 grams. The curcumin content of yellow temulawak was obtained at 0.98%. Keywords: Temulawak, curcumin, TLC-Densitometry Abstrak Temulawak atau Curcuma xanthorrhiza Roxb merupakan tumbuhan yang sangat terkenal di Indonesia, bahkan di dunia. Temulawak merupakan tanaman yang sering digunakan sebagai obat dan dapat ditemukan di hutan tropis. Tujuan dari penelitian ini adalah untuk mengetahui morfologi tanaman temulawak kuning dan menganalisis kandungan senyawa kurkumin yang terdapat pada temulawak kuning. Penelitian ini menggunakan KLT-Densitometri. Sampel yang digunakan adalah temulawak kuning yang terdapat di Desa Kinilow Kota Tomohon Provinsi Sulawesi Utara. Untuk pengamatan morfologi, hanya satu tumbuhan yang dijadikan objek pengamatan. Berdasarkan hasil penelitian dapat disimpulkan morfologi temulawak kuning memiliki tinggi tanaman 1,29 m, tinggi batang 79 cm, panjang daun 71 cm, lebar daun 26 cm. Temulawak berwarna putih, ungu dan hijau muda. bunga, panjang akar 13 cm, dan berat rimpang 250 gram. Kandungan kurkumin temulawak kuning diperoleh sebesar 0,98%. Kata kunci: Temulawak, kurkumin, KLT-Densitometri

The Effect Of Several Concentrations Of Growth Regulatory Substance (ZPT) Auxin NAA (Naphthalene Acetic Acid) On The Root Growth Of Vanila (Vanila planifolia Andrew) Cuttings Raesita Dorhayne Timburas; Arthur G. Pinaria; Edy F. Lengkong
Jurnal Agroekoteknologi Terapan Vol. 4 No. 1 (2023): EDISI JANUARI-JUNI 2023
Publisher : Sam Ratulangi University

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.35791/jat.v4i1.44100

Vanilla cultivation is generally propagated vegetatively, namely by stem cuttings, but the growth potential is still very low, so special treatment is required, such as giving growth regulators (ZPT) which can stimulate growth. ZPT which is often found in the market is Auxin which functions to stimulate growth and stimulate cell division and enlargement. The use of auxin NAA growth regulator causes faster and longer root formation, forming a strong, compact and fibrous root system. This study was an experimental study using a completely randomized design (CRD) consisting of 7 treatments and 5 replications so that the number of plants was 35 plants. The observed variables measured were root growth time, root length, and root dry weight. The results of the research statistically showed that the ZPT NAA treatment had a significant effect on the root appearance and root length variables, but had no significant effect on the root length variable. Keywords: Vanilla, ZPT, Auxin NAA Abstrak Budidaya vanili umumnya diperbanyak secara vegetatif yaitu dengan stek batang, namun potensi tumbuhnya masih sangat rendah sehingga diperlukan perlakuan khusus seperti pemberian zat pengatur tumbuh (ZPT) yang dapat merangsang pertumbuhan. ZPT yang banyak dijumpai di pasaran adalah Auksin yang berfungsi untuk merangsang pertumbuhan dan merangsang pembelahan dan pembesaran sel. Penggunaan zat pengatur tumbuh auksin NAA menyebabkan pembentukan akar lebih cepat dan lama, membentuk sistem perakaran yang kuat, kompak dan berserat. Penelitian ini merupakan penelitian eksperimen dengan menggunakan metode Rancangan Acak Lengkap (RAL) yang terdiri dari 7 perlakuan dan 5 ulangan sehingga jumlah tanaman adalah 35 tanaman. Variabel pengamatan yang diukur adalah waktu tumbuh akar, panjang akar, dan berat kering akar. Hasil penelitian secara statistik menunjukkan bahwa perlakuan ZPT NAA berpengaruh nyata terhadap variabel kenampakan akar dan panjang akar, namun tidak berpengaruh nyata terhadap variabel panjang akar. Kata kunci: Vanili, ZPT, Auxin NAA

Incidence of rust disease (Puccinia polysora Underw.) on Manado Kuning maize (Zea mays L.) in West Langowan District Christian Christhopher Sambur; Arthur G. Pinaria; Bernadeth Vivi Montong
Jurnal Agroekoteknologi Terapan Vol. 4 No. 1 (2023): EDISI JANUARI-JUNI 2023
Publisher : Sam Ratulangi University

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.35791/jat.v4i1.44120

Disease incidence of leaf rust disease in Manado Kuning maize is strongly influenced by the environment, that is temperature and humidity. The development of this disease can also occur in every planting season of Manado Kuning corn in West Langowan District. The direction of the wind greatly affects the spread of this disease so that this disease still exists in the Manado Kuning corn plantation in West Langowan District. The purpose of this study was to determine the incidence of rust disease in Manado Kuning corn plants in West Langowan District. This research took place in October 2022. The research was conducted using a survey method using purposive sampling. By using diagonal sampling on five plots of 2x2m square in each sample garden. Followed by observations at the Laboratory of Plant Diseases, Faculty of Agriculture, University of Sam Ratulangi Manado for microscopic observations of the morphology of urediospores. The results of this study showed the percentage of attacks was 91.2% in Langowan Barat District which was distributed in eight villages namely Noongan I Village 80.5%, Noongan III Village 88.9%, South Raringis Village 94.1%, Ampreng Village 92.3%, Tumaratas Village 94.8%, Kopiwangker Village 97.03 %, Walewangko Village 90.7%, and Raranon Village 91.3%. Keywords: Corn, Incidence, Puccinia polysora. Abstrak Kejadian penyakit penyakit karat daun pada jagung kuning Manado sangat dipengaruhi oleh lingkungan yaitu suhu dan kelembaban. Perkembangan penyakit ini juga dapat terjadi pada setiap musim tanam jagung Manado Kuning di Kabupaten Langowan Barat. Arah angin sangat mempengaruhi penyebaran penyakit ini sehingga penyakit ini masih ada di perkebunan jagung Manado Kuning di Kecamatan Langowan Barat. Tujuan dari penelitian ini adalah untuk mengetahui kejadian penyakit karat pada tanaman jagung Manado Kuning di Kecamatan Langowan Barat. Penelitian ini dilaksanakan pada bulan Oktober 2022. Penelitian dilakukan dengan metode survei dengan menggunakan purposive sampling. Dengan pengambilan sampel secara diagonal pada lima petak berukuran 2x2m persegi pada setiap kebun sampel. Dilanjutkan dengan pengamatan di Laboratorium Penyakit Tumbuhan Fakultas Pertanian Universitas Sam Ratulangi Manado untuk pengamatan mikroskopis morfologi urediospora. Hasil penelitian ini menunjukkan persentase serangan sebesar 91,2% di Kecamatan Langowan Barat yang tersebar di delapan desa yaitu Desa Noongan I 80,5%, Desa Noongan III 88,9%, Desa Raringis Selatan 94,1%, Desa Ampreng 92,3%, Desa Tumaratas 94,8%. %, Desa Kopiwangker 97,03%, Desa Walewangko 90,7%, dan Desa Raranon 91,3%. Kata Kunci: Jagung, Insidens, Puccinia polysora.

RESPONS PERTUMBUHAN DAN PRODUKSI KENTANG MEDIANS TERHADAP PEMUPUKAN NPK DI KELURAHAN RURUKAN PROPINSI SULAWESI UTARA Lydia Elisabeth Agatha Tulung; Arthur G. Pinaria; Jailani ., Husain
AGRI-SOSIOEKONOMI Vol. 17 No. 2 MDK (2021)
Publisher : Sam Ratulangi University

This study aimed to analyze the response of growth and production of Median potatoes to the application of various doses of Phonska NPK fertilizer in Rurukan Village, North Sulawesi Province. This research was conducted from August to November 2020 in Rurukan Village, East Tomohon District, Tomohon City. The design used was a Randomized Completely Blocked Design (RCBD) with six (6) treatments and three (3) replications consisting of P1 Fertilization Treatment (150 kg/ha), P2 NPK Fertilization Treatment (300 kg/ha), P3 NPK Fertilization Treatment (450 kg/ha), P4 NPK Fertilization Treatment (600 kg/ha), P5 NPK Fertilization Treatment (750 kg/ha) and P6 NPK Fertilization Treatment (900 kg/ha). The results showed that (1) the treatment with Phonska NPK fertilizer at a dose of 450 kg/ha had a significant effect on the growth and production components of the Medians potato plant in Rurukan Village, North Sulawesi Province and (2) the highest plant productivity was obtained in the treatment of Phonska NPK fertilizer with dose 450 kg/ha = 18, 11 tons/ha.

INTERAKSI VARIETAS KEDELAI DAN SAAT PEMBERIAN CEKAMAN KEKERINGAN PADA PERTUMBUHAN DAN HASIL TANAMAN KEDELAI (Glycine Max. (L.) Merril) Claudia Juniar Monggesang; Wenny ., Tilaar; Arthur G. Pinaria
AGRI-SOSIOEKONOMI Vol. 17 No. 3 MDK (2021)
Publisher : Sam Ratulangi University

This study aims to determine the interaction of varieties and drought stress on the growth and yield of two varieties of soybean (Glycine max (L.) Merill). This research was carried out using polybags in the greenhouse of the Faculty of Agriculture, Sam Ratulangi University with the experimental design used in this study was environmental design and treatment design was Completely Randomized Design (CRD). Research data from all observational variables were analyzed by analysis of variance ANOVA and if there was a difference between treatments, it was continued with the 5% BNT test. The results of this study indicate that the character of soybean harvesting age is influenced by the interaction of varietal factors and drought stress factors. Drought stress factors affect the character of plant height, number of main branch books, number of pods planted, and number of seeds planted. Varieties and drought stress factors did not affect the observed characteristics of the first flowering age, the number of root nodules, the number of empty pods, and the weight of 100 seeds per plant.

ANALISIS KANDUNGAN SULFORAFAN PADA FASE KECAMBAH BEBERAPA JENIS BROKOLI DALAM MEDIA MS YANG DIBERIKAN NAA DAN BAP SECARA IN VITRO Edy F. Lengkong; Wenny ., Tilaar; Arthur ., Pinaria
AGRI-SOSIOEKONOMI Vol. 18 No. 1 (2022)
Publisher : Sam Ratulangi University

This study aims to: (1) determine the content of sulforaphane in several types of broccoli sprouts. (2) Knowing the difference in sulforaphane content in the combination of NAA, BAP and types of broccoli grown on MS media; (3) knowing the difference in sulforaphane content in the combination of NAA and types of broccoli sprouts grown on MS media; (4) knowing the difference in sulforaphane content in the combination of BAP and the type of broccoli sprouts grown on MS media. This study used a completely randomized design (CRD) arranged in a factorial manner, namely factor A: NAA 0, 0,5, and 1 ppm. B: BAP 0, 1, 2 ppm and C : 2 Types of Broccoli. The variables observed were: germination time, germination weight, and sulforaphane content. The data were analyzed by analysis of variance and continued with the 5% BNT test. The results showed that germination time began to appear on day 3 and all seeds germinated. Sprout weight varied greatly, and the combination of treatments N1, B0 and BR2 gave the highest average weight and calculated concentration (ENT) of sulforaphane, followed by treatments N0B2BR2 and N0,5B0BR1.

CONTROL OF SUBTERRANEAN TERMITE PESTS Coptotermes sp. (Blattodea: Rhinothermitidae) USING COCONUT SHELL LIQUID SMOKE Patricia Mandagi; Arthur G. Pinaria; Jackson F. Watung; Frangky J. Paat; James B. Kaligis; Sandra E. Pakasi
Jurnal Agroekoteknologi Terapan Vol. 4 No. 2 (2023): EDISI JULI-DESEMBER 2023
Publisher : Sam Ratulangi University

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.35791/jat.v4i2.50554

Subterranean termite Coptotermes sp. is one of the important pests that pose a threat to agriculture. Coconut shell liquid smoke is the result of a pyrolysis distillation process. The content of compounds in liquid smoke includes phenolic compounds, carboxylic acids, and carbonyls. The objective of the study was to determine the effective concentration of coconut shell liquid smoke to control the subterranean termite Coptotermes sp. This study used a completely randomized design (CRD) with 5 treatments, 1 treatment (control), and 4 replications. Subterranean termites used were 300 subterranean termites, each treatment filled with 15 termites (12 workers and 3 soldiers). The research data was calculated to obtain the total mortality percentage of Coptotermes sp. on the last observation. Data were analyzed using Sidik Ragam (ANOVA). If the concentration of the treatment shows a significant effect, then proceed with the 5% LSD (Least Significant Difference) test. Control of the Coptotermes sp. subterranean termite. with coconut shell liquid smoke grade 3 effect on the mortality of Coptotermes sp. subterranean termites. Treatment with a concentration of 1 ml of coconut shell liquid smoke is effective and economical to be used as an organic insecticide among other treatments in controlling Coptotermes sp. subterranean termites. Keywords: Control, Mortality, Rayap Subteran, Coconut Shell Liquid Smoke Abstrak Rayap bawah tanah Coptotermes sp. merupakan salah satu hama penting yang menjadi ancaman dalam bidang pertanian. Asap cair tempurung kelapa merupakan hasil proses destilasi pirolisis. Kandungan senyawa pada asap cair antara lain senyawa fenolik, asam karboksilat dan karbonil. Tujuan penelitian adalah untuk mengetahui konsentrasi asap cair tempurung kelapa yang efektif untuk mengendalikan rayap tanah Coptotermes sp. Penelitian ini menggunakan rancangan acak lengkap (RAL) dengan 5 perlakuan, 1 perlakuan (kontrol) dan 4 ulangan. Rayap tanah yang digunakan sebanyak 300 ekor rayap, masing-masing perlakuan diisi 15 ekor rayap (12 pekerja dan 3 prajurit). Data penelitian dihitung untuk memperoleh persentase kematian total Coptotermes sp. pada pengamatan terakhir. Data dianalisis menggunakan Sidik Ragam (ANOVA). Apabila konsentrasi perlakuan menunjukkan pengaruh nyata maka dilanjutkan dengan uji LSD (Beda Nyata Terkecil) 5%. Pengendalian Coptotermes sp. rayap bawah tanah. dengan asap cair tempurung kelapa grade 3 berpengaruh terhadap mortalitas Coptotermes sp. rayap bawah tanah. Perlakuan dengan konsentrasi 1 ml asap cair tempurung kelapa efektif dan ekonomis untuk digunakan sebagai insektisida organik diantara perlakuan lain dalam mengendalikan Coptotermes sp. rayap bawah tanah. Kata Kunci: Pengendalian, Kematian, Rayap Subteran, Asap Cair Batok Kelapa

Title

Found 11 Documents
Search

Abstract

Abstract

Abstract

Abstract

Abstract

Abstract

Abstract

Abstract

Abstract

Abstract

Title Search

Found 11 Documents Search

Abstract

Abstract

Abstract

Abstract

Abstract

Abstract

Abstract

Abstract

Abstract

Abstract

Title

Found 11 Documents
Search