Article Per Year (5 Year)
p-Index From 2019 - 2024
0.659
P-Index
This Author published in this journals
All Journal SAINS MEDIKA : JURNAL KEDOKTERAN DAN KESEHATAN Jurnal Kedokteran Diponegoro Journal of Biomedicine and Translational Research Indonesian Journal of Biotechnology Herb-Medicine Journal Jurnal Sains Teknologi Akuakultur
Purnomo Hadi
Faculty Of Medicine Diponegoro University
Agriculture, Biological Sciences & Forestry Biochemistry, Genetics & Molecular Biology Health Professions Immunology & microbiology Materials Science & Nanotechnology Medicine & Pharmacology Public Health

Published : 8 Documents Claim Missing Document
Claim Missing Document
Check
Articles

Found 8 Documents
Search

 1 
Molecular Genotyping of HBV by using Nested PCR-RFLP among Hepatitis B Patients in Daerah Istimewa Yogyakarta Province and Surrounding Area Haryanto, Aris; Mulyani, Nenny Sri; Widowati, Titis; Wijayanti, Nastiti; Hadi, Purnomo
Indonesian Journal of Biotechnology Vol 13, No 2 (2008)
Publisher : Universitas Gadjah Mada

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (233.942 KB)

Abstract

Hepatitis B virus (HBV) can be classified into 8 genotypes, genotype A to H. Genotype of HBV is important for clinical and etiological investigations. Research for HBV genotyping, HBV transmission study using nested PCR and HBV genotyping based on RFLP using restriction enzymes have been reported. However, both of those methods have been not applied for HBV genotyping study among hepatitis B patients in endemic area, like Indonesia yet. Molecular genotyping of HBV will describe epidemiology, pathogenesis and clinical implication of HBV. Combination of nested PCR and RFLP (nested PCR-RFLP) method to determine HBV genotype in Indonesia is still less information. The objectives of study were to develop a system for HBV genotyping by nested PCR combined with RFLP (nested PCR-RFLP) method based on nucleotide sequence of surface protein encoding</div><div>gene (S gene) in HBV genome and to confirm HBV genotypes which predominantly found among hepatitis B patients in Daerah Istimewa Yogyakarta Province and surrounding area. Total of 149 sera from chronic hepatitis B patients from Daerah Istimewa Yogyakarta and surrounding areas were collected for in this work. Viral DNA were extracted from sera of hepatitis B patients and used as template for first round nested PCR amplification using outer primers set. Amplicons of first round PCR were used as template for second round amplification using inner primers set. Then, amplicons of second round nested PCR were restriction digested by Sty I and Bsr I enzymes. For HBV genotyping then the restriction products were analyzed by RFLP based on restriction pattern. Results showed that the first round nested PCR amplification generated DNA fragments of whole S gene in length 1.233 bp, and in second round nested PCR amplification using inner primer set generated DNA fragments 585 bp in length. Genotype analysis for all samples using nested PCR-RFLP methods by restriction digested of Sty I and Bsr I enzymes found only 2 HBV genotypes among hepatitis B patients, namely genotype B and C. Quantification</div><div>data showed that most of hepatitis B patients found infected by HBV genotype B (92,8%), genotype C (3,6%) and unidentified genotype (3,6%). Nested PCR-RFLP methods for HBV genotyping is simple and inexpensive for clinical diagnostic in large scale.
UJI BEDA SENSITIVITAS KUMAN NEISSERIA GONORRHOEAE TERHADAP LEVOFLOKSASIN DENGAN TIAMFENIKOL SECARA IN VITRO Budiono, Maria Diandra Christie; Muslimin, Muslimin; Hadi, Purnomo
DIPONEGORO MEDICAL JOURNAL (JURNAL KEDOKTERAN DIPONEGORO) Vol 6, No 2 (2017): JURNAL KEDOKTERAN DIPONEGORO
Publisher : Faculty of Medicine, Diponegoro University, Semarang, Indonesia

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (460.558 KB) | DOI: 10.14710/dmj.v6i2.18597

Abstract

Latar belakang: Gonore adalah salah satu infeksi menular seksual yang disebabkan kuman Neisseria gonorrhoeae. Terapi yang digunakan untuk gonore mengalami perubahan karena tingginya angka resistensi antibiotik. Penggunaan antibiotik yang sudah resisten dapat meningkatkan kegagalan terapi, maka dari itu uji sensitivitas antibiotik harus sering dilakukan terutama antibiotik yang menjadi standar terapi, yaitu  levofloksasin dan tiamfenikolTujuan: Menilai perbedaan sensitivitas kuman Neisseria gonorrhoeae terhadap levofloksasin dengan tiamfenikol secara in vitro Metode: Penelitian ini merupakan penelitian observasional dengan rancanganCross-sctional design. Sampel adalah biakan kuman Neisseria gonorrhoeae yang didapatkan dari hasil swab endoserviks penderita yang dikonfirmasi melalui pengecatan gram, tes oksidase, uji fermentasi, dan kultur pada media Thayer-Martin Agar. Biakan kuman kemudian diinokulasi pada media Mueller Hinton- Thayer Martin Agar lalu diletakan disk levofloksasin dan kertas saring tiamfenikol dan dilakukan pengukuran zona hambat yang terbentuk dengan penggaris. Masing-masing kelompok penelitian terdiri dari 14 sampel. Uji hipotesis menggunakan uji Chi-squareHasil: Sensitivitas kuman Neisseria gonorrhoeaea terhadap levofloksasin adalah 0% sedangkan terhadap tiamfenikol sensitivitasnya sebesar 71, 43%, dan terdapat perbedaan bermakna antara levofloksasin dengan tiamfenikol ( p <0.05)Simpulan: Terdapat perbedaan bermakna sensitivitas kuman Neisseria gonorrhoeae terhadap levofloksasin dengan tiamfenikol secara in vitro dan sensitivitas kuman Neisseria gonorrhoea terhadap tiamfenikol lebih sensitif daripada levofloksasin.
Pemanfaatan Sari Belimbing Wuluh (Averrhoa bilimbi L.) pada Pemeliharaan Udang Vaname (Litopenaeus vannamei) untuk Menekan Populasi Bakteri Vibrio sp. Koloni Hijau Handayani, Sri; Dwinanti, Sefti Heza; Hadi, Purnomo
Jurnal Masyarakat Akuakultur Indonesia Vol 3, No 1 (2019): In Press
Publisher : Masyarakat Akuakultur Indonesia

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (423.238 KB)

Abstract

Sri Handayani, Sefti Heza Dwinanti and Purnomo Hadi. 2020. Utilization of Carambola Sari (Averrhoa bilimbi L.) in the Maintenance of Vaname Shrimp (Litopenaeus vannamei) to Suppress Population of Vibrio sp. Green Colony. Jurnal Sains Teknologi Akuakultur, 3(1) : 33-41. This research was conducted in July-August 2018 at PT. SyAqua Indonesia Serang, Banten. It used Completely Randomized Design (CRD) with three replicates and three treatments which were bilimbi juice in 20 ppm (T1), 30 ppm (T2) and without bilimbi or control (CT). The monitoring of Vibrio sp., defined as total Vibrio sp., total   yellow colony, total green colony, the ratio of total green colony, survival rate of shrimp and water quality. The result showed that bilimbi juice was able to suppress the population of Vibrio sp. in the maintenance media and shrimp body. At the end of the maintenance period (d7-d9), total population of green colony in treatment were lower than control with the ratio of the green colony was 0%. In contrast, bilimbi juice with concentration 20 ppm and 30 ppm had no significant effect (P>0,1). The best survival rate was given by T2 about 16% and based on regression y = 0.3589x+5.0279 the optimal dose to protect shrimp from Vibrio sp. by using bilimbi juice is about 264,62 ppm.
THE EFFICACY OF TOPICAL CLINDAMYCIN GEL ON SEVERITY DEGREE OF ACNE VULGARIS AMONG FEMALE COLLEGE STUDENTS Hapsari, Rani Puspita; Widayati, Retno Indar; Afriliana, Liza; Hadi, Purnomo
DIPONEGORO MEDICAL JOURNAL (JURNAL KEDOKTERAN DIPONEGORO) Vol 9, No 4 (2020): DIPONEGORO MEDICAL JOURNAL ( Jurnal Kedokteran Diponegoro )
Publisher : DIPONEGORO MEDICAL JOURNAL (JURNAL KEDOKTERAN DIPONEGORO)

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (424.391 KB)

Abstract

Background: Acne vulgaris is a chronic inflammatory disease in the pilosebaceous follicle of the skin as the result of Propionibacterium acnes colonization. Clindamycin is an antibiotic that is effective against most gram-positive anaerobic bacteria such as the strain of  Propionibacterium sp. Clindamycin in topical form inhibits P. acnes lipase enzyme resulting in the decrease of free fatty acid on the skin surface and the decrease of the Propionibacterium acnes population.  Aim: To know the effect of topical clindamycin gel application on the severity degree of acne vulgaris among female college students of Diponegoro University. Methods: The study has done on 34 female college students of Diponegoro University who were diagnosed with Acne Vulgaris. All of the subjects underwent a face skin examination where the acne lesions were counted before and after the treatment. The treatment given was the application of clindamycin topical gel once a day for four weeks. The counted acne lesions were classified into the severity degree of acne vulgaris by Plewig and Kligman. The study compared the severity degree of acne vulgaris before and after the treatment. Statistical analysis of this study used the Wilcoxon test. Result: The result of pre and post-treatment data showed a significant decrease in the severity degree of acne vulgaris after the treatment application (p=0.000). The decrease of severity degree was marked by the decrease of acne lesion count after having four weeks of treatment. This significant result indicated an effective recovery of acne vulgaris after being given the treatment of topical clindamycin. The antibiotic and anti-inflammation effects of clindamycin were discovered effectively healing the lesions of acne vulgaris, therefore, decreasing its severity. Conclusion: Topical clindamycin can effectively reduce the severity degree of acne vulgaris among female college students of Diponegoro University.
Active Cytomegalovirus Infection in Critically Ill Immunocompeten Patients Admitted in the ICU. A Molecular Diagnosis Approach Tania Tedjo Minuljo; Muhammad Hussein Gasem; Purnomo Hadi
Journal of Biomedicine and Translational Research Vol 3, No 1 (2017): July 2017
Publisher : Faculty of Medicine, Diponegoro University

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (36.211 KB) | DOI: 10.14710/jbtr.v3i1.866

Abstract

Background: Active Cytomegalovirus (CMV) infection has long been related to immunocompromised conditions such as malignancy, HIV-AIDS, longterm use of corticosteroids and organ transplantation. Nowadays, several studies showed that active CMV infection also frequently found in formerly immunocompetent patients during critically ill condition. Alteration of immune system in critically ill condition might become the most possible reason enderlying this adverse event.Aim: To document the prevalence of active CMV infection in critically ill immunocompetent patient admitted to ICU and to find out the difference of the disease severity between group of patients with and without active CMV infection.Method: This was a cross sectional study. Study conducted from April 1st - June 30th 2013. Subjects were patient aged ≥14 years, hospitalized in the ICU of Dr. Kariadi Hospital, Semarang, Indonesia. Patients who had history of malignancy, HIV-AIDS, use of corticosteroids and organ transplatation were excluded from the study. Disease severity was calculated using APACHE II score in the first 24 hours of ICU admission. EDTA sample for qualitative PCR examination (procedure as described elsewhere) collected after 4 days of ICU admission. Primer for CMV were as follow CMV-F: CATGAAGGTCTTTGCCCAGTAC, CMV-R: GGCCAAAGTGTAGGCTACAATAG. Datas were analyzed using bivariate analysis.Result: Active CMV infection was detected in 16 out of 50 subjects. Mean score of disease severity in all subjects (based on APACHE II scoring system) was 11.8±6.43. Mean score of disease severity in group with active CMV infection was higher than group without active CMV infection, but not differ significantly (12.75 vs. 11.47; p=0,510).Conclusion: The prevalence of active CMV infection in critically ill immunocompetent patient is relatively high (16/50; 32%) in the ICU of Dr. Kariadi Hospital, Semarang, Indonesia. Degree of disease severity might influence the occurance of CMV infection. Qualitative PCR testing was an aqurate tool for diagnosing active CMV infection.
Lung Tuberculosis with Multi Drug Resistant Risk in Tertiary Hospital in Middle Java Ratna Wulan Febriyanti; Winarto Winarto; Mujahidah Mujahidah; Endang Sri Lestari; Purnomo Hadi; Vincentia Rizke Ciptaningtyas
Herb-Medicine Journal: Terbitan Berkala Ilmiah Herbal, Kedokteran dan Kesehatan Vol 4, No 2 (2021): Herb-Medicine Journal April 2021
Publisher : Universitas Muhammadiyah Purwokerto

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.30595/hmj.v4i2.10352

Abstract

World TB report from World Health Organization (WHO) in 2017 informed that Indonesia was second country with TB case. Multi Drug Resistance pulmonary infection’s case in Indonesia were 12.000. Kariadi hospital is one of tertiary hospital for pulmonary MDR-TB treatment but, there is no study about risk factor of it yet, so it needed to find risk factors of MDR-TB pulmonary infection in Kariadi hospital. Cross Sectional design using secondary data from Medical Record  from January 1st -  December 31, 2017 with result of Mycobacterium tuberculosis on GeneXpert sputum examination. Bivariate analysis with Chi square test and multivariate analysis was done by multiple logistic regression. The p value was considered significant if <0.05, all analyzes were 2-tailed. Totally 110 patients were obtained during periode, 55 samples for case and 55 samples for control. There were correlation between smoking habit OR = 3,1 (CI 95% 1,1-8,7), malnutrition OR = 2,9 (CI 95% 1,3-6,3), contact with patient with MDR pulmonary TB infection OR = 12,0 (CI 95% 1,5-97,3), past treatment  OR = 81,7(CI 95% 23,4-285,2) and ≥6months past treatment OR = 94,5 (CI 95% 12,1-736,2. Risk factor that could influence together were contact with patient with MDR pulmonary TB infection OR = 34,5 (CI 95% 2,6-464,5), past treatment OR = 39,4 (CI 95% 8,3-186,3) and ≥ 6months past treatment OR = 12,4 (CI 95% 1,3-117,7). Risk factors for the incidence of pulmonary MDR TB infection are past contact with patient with MDR pulmonary TB infection, past treatment  and  ≥ 6months past treatment.
The Definitive Diagnosis of Tuberculous Meningitis (TBM) di RSUP dr. Kariadi Semarang Descriptive study in adult patients using IS6110-based PCR amplification for detecting Mycobacterium tuberculosis Masfiyah, Masfiyah; Bintoro, Aris Catur; Hadi, Purnomo
Sains Medika : Jurnal Kedokteran dan Kesehatan Vol 5, No 2 (2013): July-December 2013
Publisher : Fakultas Kedokteran; Universitas Islam Sultan Agung (UNISSULA)

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (1495.152 KB) | DOI: 10.30659/sainsmed.v5i2.343

Abstract

Tuberculous meningitis (TBM) is the most common cause of central nervous system infection and has very high morbidity and mortality. The definitive diagnosis of TBM in RSUP dr Kariadi Semarang has been insufficient. This study aimed at finding out the definitive diagnosis of TBM di RSUP dr Kariadi Semarang using IS6110 sensitive and specific primer. This was a descriptive study included all in-patients with meningitis and/or TBM of RSUP Dr Kariadi Semarang aged > 14 years with Thwaites’ Diagnostic Score ≤ 4 between March 1, 2013 and November, 30 2013. The devinitive diagnosis of TBM was made using IS6110-based PCR amplification for detecting Mycobacterium tuberculosis complex conducted in microbiology clinic of FK UNDIP/RSUP dr. Kariadi Semarang. The secondary data was the basic and laboratory data from the medical records of the patients. Mean age was 39.59 ± 15.7. Six (35.3%) pasients were diagnosed with devinitive TBM, 3 (17.64%) were meningitis positive by NTM (Non Tuberculous Mycobacteria). Dual infection was found in 1 (5.8%) case between TBM and bacterial meningitis. Most patients were productive age. Some had devititive TBM. The pasient with meningitis and dual infection were also diagnosed with NTM (Non Tuberculous Mycobacteria).
Prevalence of Influenza Viruses (Influenza Like Illness) In Regional Laboratory Avian Influenza Semarang Wahyutomo, Ridha; Ciptaningtyas, V. Rizke; Hadi, Purnomo
Sains Medika : Jurnal Kedokteran dan Kesehatan Vol 3, No 2 (2011): Juli-Desember 2011
Publisher : Fakultas Kedokteran; Universitas Islam Sultan Agung (UNISSULA)

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (201.918 KB) | DOI: 10.30659/sainsmed.v3i2.398

Abstract

Background: Influenza is the major health threat worldwide causing illness and death every year. However, data on the epidemiology of influenza in tropical countries, including Indonesia, are still limited. Up dated data for its prevalence is needed to monitor its spreading and to evaluate its outbreak. Therefore a working regional laboratory in surveillance of ILI (Influenza Like Illness) was formed. This research was conducted to provide updated data on prevalence of ILI in regional laboratorium avian influenza Semarang.Design and Method: Data from patients examined in the regional laboratory of avian influenza Semarang from April 2009 until December 2010 was collected. Samples were obtained from Malang sentinel, Yogyakarta sentinel and Semarang sentinel. Samples were examined using PCR to detect influenza A, influenza B, and swine flu.Result: out 1367 patients tested, 279 patients (20.41%) were from Yogyakarta sentinel, 619 patients (45.28%) were from Malang sentinel, and 467 patients (34.16%) were from Semarang sentinel. Flu A virus was detected in 117 patients (8.5%). Influenza B virus was found in 39 patients (2.8%). H1 virus was detected in 5 patients (0.36%). H3 virus was detected in 45 patients (3.29%). Swine flu virus was detected in 3 patients in Malang.Conclusion: The highest prevalence of flu A and flu B examined in avian influenza regional laboratory Semarang was from Semarang sentinel, followed by Yogyakarta sentinel and Malang (Sains Medika, 3(2):157-161).
Co-Authors Afriliana, Liza Ali Djamhuri Aris Catur Bintoro Aris Haryanto Budiono, Maria Diandra Christie Endang Sri Lestari Hapsari, Rani Puspita Masfiyah Masfiyah, Masfiyah Muhammad Hussein Gasem Mujahidah Mujahidah Nastiti Wijayanti Nenny Sri Mulyani Ratna Wulan Febriyanti Retno Indar Widayati Ridha Wahyutomo Sefti Heza Dwinanti, Sefti Heza Sri Handayani Tania Tedjo Minuljo Titis Widowati, Titis V. Rizke Ciptaningtyas Winarto Winarto