Article Per Year (5 Year)
p-Index From 2019 - 2024
2.687
P-Index
This Author published in this journals
All Journal Natural Science: Journal of Science and Technology Jurnal INKOM Jurnal Buana Informatika Jurnal Simantec Research Journal of Life Science Jurnal Teknologi Informasi dan Ilmu Komputer The Journal of Pure and Applied Chemistry Research SMATIKA Proceeding of the Electrical Engineering Computer Science and Informatics Jurnal Farmasi Sains dan Komunitas (JFSK) JURNAL MANAJEMEN DAN PELAYANAN FARMASI (Journal of Management and Pharmacy Practice) Jurnal SOLMA JAST : Jurnal Aplikasi Sains dan Teknologi jurnal teknik informatika dan sistem informasi JAPI (Jurnal Akses Pengabdian Indonesia) JAPI: Jurnal Akses Pengabdian Indonesia Sainsbertek Jurnal Ilmiah Sains & Teknologi Prosiding Seminar Nasional Pengabdian Masyarakat Journal of Embedded Systems, Security and Intelligent Systems
Kestrilia Rega Prilianti
Departement Of Informatics Engineering, Ma Chung University
Agriculture, Biological Sciences & Forestry Arts Humanities Chemical Engineering, Chemistry & Bioengineering Chemistry Computer Science & IT Decision Sciences, Operations Research & Management Economics, Econometrics & Finance Education Electrical & Electronics Engineering Engineering Environmental Science Health Professions Industrial & Manufacturing Engineering Languange, Linguistic, Communication & Media Materials Science & Nanotechnology Medicine & Pharmacology Nursing Public Health Social Sciences Other

Published : 31 Documents Claim Missing Document
Claim Missing Document
Check
Articles

Found 2 Documents
Search
Journal : Research Journal of Life Science

 1 
Fourier Transform Infrared (FTIR) Spectroscopy Method for Fusarium solani Characterization Ifa Maulidah Hasanah; Mintarto Martosudiro; Luqman Qurata Aini; Kestrilia Rega Prillianti; Matheus Randy Prabowo
Research Journal of Life Science Vol 9, No 1 (2022)
Publisher : Lembaga Penelitian dan Pengabdian kepada Masyarakat, Universitas Brawijaya

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.21776/ub.rjls.2022.009.01.3

Abstract

The detection and identification of microorganisms using spectroscopy techniques promise to be of great value because of their sensitivity, rapidity, low expense, and simplicity.  In this study, we used FTIR spectroscopy for the characterization of Fusarium solani. PCR amplification of DNA extracted from these isolates showed the possibility of amplifying PCR products with sizes 559 bp using the ITS1-ITS4 primers. Based on phylogenetic tree analysis, the isolate of F. solani showed a closely relationship to Fusarium solani isolate MN (MH300495.1) with 99.63% similarity.  The study is focused on the carbohydrate structure which can be analyzed in the range of 900 to 1200 cm-1 of FTIR wavenumber.  The spectra of our samples share similarities with one another, although small differences occur in the absorbance value. The band at 1027 cm-1 is assigned to the C-O stretching of glycogen. Meanwhile, at 1042 cm-1 is interpreted as carbohydrate C-O stretching as well. The band around 1073 cm-1 might arise from both chitin C-C stretching and phosphate stretching of nucleic acids. Other vibrations associated with chitin are also found at 1115 cm-1 and 1151 cm-1 which are assigned to C-O-C symmetric stretching and C-O-C asymmetric stretching, respectively.
Characterization of Ralstonia solanacearum Using Fourier Transform Infrared (FTIR) Spectroscopy Nur Ma'alifah; Luqman Qurata Aini; Abdul Latief Abadi; Kestrilia Rega Prillianti; Matheus Randy Prabowo
Research Journal of Life Science Vol 9, No 2 (2022): : IN PRESS
Publisher : Lembaga Penelitian dan Pengabdian kepada Masyarakat, Universitas Brawijaya

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.21776/ub.rjls.2022.009.02.2

Abstract

Ralstonia solanacearum, the causal agent of bacterial wilt disease is worldwide in distribution, and results in serious economic losses, particularly in the tropics. Detection and characterization of microorganisms by Fourier transform infrared spectroscopy (FTIR) technique promises to be of great value because of the method’s inherent sensitivity, small sample size, rapidity, and simplicity. In this study, we used FTIR spectroscopy for the characterization of Ralstonia solanacearum. The bacteria were grown on Nutrient Agar (NA) at 28°C for 48 hours. The colonies of Ralstonia solanacearum on nutrient agar medium were smooth circular, raised, and dirty white. Cultures of bacteria were identified by molecular methods using PCR techniques. The DNA was amplified using a specific primer pair, 759f/760r (forward primer: 5'- GTCGCCGTCAACTCACTTTCC 3’, reverse primer: 5'-GTCGCCGTAGCAATGCGGAATCG-3’). The PCR produced a single band of 280 bp from the isolated DNA of cultured bacteria.  Bacterial spectra were obtained in the wavenumber range of 4000–400 cm-1 using FTIR spectroscopy. The identification of cell wall constituents in region 3000–2800 cm-1, the proteinaceous structure of bacteria in region 1665–1200 cm-1, and the fingerprint of bacteria in region 1200-800 cm-1 are all part of the spectra analysis in this study. Absorption bands obtained from bacteria Ralstonia solanacearum samples associated with protein, phospholipids, nucleic acids, and carbohydrates appear in the bacterial IR absorption spectra.
Co-Authors A.S. Adhiwibawa, Marcelinus Abdul Latief Abadi Agus Suryanto Alfanaar, Rokiy Anam, Syaiful Anitarakhmi Handaratri, Anitarakhmi Christianto O, Ivan Dewi Fandelia Tan Edward Hendryawan Michael Endhirayanti Caesarika Eva Monica Felix Adrian Tjokro Atmodjo Felix Adrian Tjokro Atmodjo Hendry Setiawan Hendry Setiawan Hendry Setiawan Ifa Maulidah Hasanah Immanuel Olive DjajaPutra Indah Lestari Irawan, Paulus Lucky Tirma Ivan C. Onggara Lo Hanjaya Hanafi Lo Hanjaya Hanafi, Lo Hanjaya Luqman Qurata Aini Luqman Qurata Aini Marcelino Centauri Dwi Prasetyo Marcelinus A.S. Adhiwibawa Marsha Anggita Amelia Martanty Aditya, Martanty Matheus Randy Prabowo Matheus Randy Prabowo Melany Melany Agustina Melany Melany Mintarto Martosudiro Mochamad Subianto Mochamad Subianto Muhammad Hilmi Afthoni Notario, Dion Nugroho, Vincentius Adhien Nur Ma'alifah Onggara, Ivan C. Paulus Lucky Tirma Irawan Paulus Lucky Tirma Irawan Paulus Lucky Tirma Irawan Paulus Lucky Tirma Irawan Prasetyo Mimboro Prasetyo Mimboro Rollando, Rollando Romy Budhi Widodo Samuel Samuel Setiawan, Hendry Sultan Arif Rahmadianto Suryanto, Agus Tan, Dewi Fandelia Tatas H.P. Brotosudarmo Theodore Zakharia Widjaja Vincentius Adhien Nugroho William Wicaksono Windra Swastika Yohanes Hans Kristian Yuniati, Yuyun