Claim Missing Document
Check
Articles

Found 1 Documents
Search
Journal : Jurnal Biodjati

Development of DNA Barcode for Magnoliopsida and Liliopsida using In silico Approaches Based on mat-K Sequences from Chloroplast Genomes Denia Dwi Citra Resmi; Topik Hidayat; Siti Sriyati
Jurnal Biodjati Vol 6, No 2 (2021): November
Publisher : UIN Sunan Gunung Djati Bandung

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.15575/biodjati.v6i2.13991

Abstract

Indonesia has been estimated to contain 20,000 species of Magnoliophyta around the world. The current status of Indonesia's biodiversity shows that only 15.5% of the total flora in Indonesia has been identified. This is such a low percentage, requires researchers to obtain a rapid identification method, so that unidentified species can be grouped, at least at the level of the Magnoliopsida and Liliopsida classes. DNA barcoding is a technique that can be used to quickly identify species based on short sequences of specific regions in the genome. The purpose of this study was to analyze the relationship between Magnoliopsida and Liliopsida plants based on the mat-K marker and to obtain DNA barcodes for each of the Magnoliopsida and Liliopsida classes. This study used an in silico approach because the molecular data about these two selected classes with 101 species for samples are abundant in Genbank NCBI database. The primary design was carried out after analyzing the phylogenetic relationship between Magnoliopsida and Liliopsida. In silico analysis using BioEdit and PAUP to reconstructthe phylogenetic tree based on mat-K DNA showed results that were in line with previous studies. The phylogenetic tree using molecular data confirms that Magnoliopsida is the ancestor of Liliopsida. This study succeeded in obtaining two pairs of specific primers for Magnoliopsida and Liliopsida, which are cttcagtggtacggagtcaaat and gagccaaagttttagcacaagaa for Magnoliopsida, whereas cccatccatatggaaatcttggt and ttgaagccagaattgcttttcc for Liliopsida. These primers can later be used to distinguish the Magnoliopsida group from Liliopsida.
Co-Authors Adi Rahmat, Topik Hidayat, Adi Rahmat, Aldeva Ilhami Almira Ivana Amalia Pratiwie Amprasto Anderias Henukh Aprilita Ekasari Ari Widodo Ari Widodo Ari Widodo Ari Widodo Arifin Ahmad Asep Irvan Irvani Asmawi Zainul Denia Dwi Citra Resmi Dian Amirulloh Diana Rochintaniawati Didik Priyandoko Didik Pryandoko Dini Nurani Rahmawati Dini Riyani Elah Nurlaelah Eliyawati Eliyawati Findi Septiani Harry Firman Harry Firman HERNANI - Ida Hamidah Ida Kaniawati Ida Kaniwati Ida Yayu Nurul Hizqiyah Ida Yayu Nurul Hizqiyah Ilham Nur Iman Maulana Kadek Sera Harlistya Udayani Laurina Sinurat Lia Lutianasari Lia Lutianasari Lilis Sulistiawati Mellyzar Mellyzar Mukhyati Mukhyati, Mukhyati Nahadi Najihah Fakhirah Siregar Nanang Winarno Ninda Eka Ratanasabilla Nur Hamidah Nuris Fattahillah Nurullina Fajri Nuryani Rustaman Oky Rizkiana Silaban Parlindungan Sinaga Pisca Hana Marsenda R. Riandi, R. Raden Ahmad Hadian Adhy Permana Raden Ahmad Hadian Adhy Permana* Rahayu Laelandi Rahmania - Firda Rahmi, Nisrina Nur Regina P. Octavianda, Regina P. Ridyah, Surya Warni Rini Solihat Rosamsi, Saiman Safira Permata Dewi Siti Tahany Rifa Faidah Solikhah Isti Fadilah Sri Rahayu Retnowulan Sri Redjeki Sri Redjeki St E Sururiyatul Muaziyah Suci Siti Lathifah Syahfitri, Jayanti Sylva Sagita Tb. Moh. Irma Ari Irawan Titin Supriyatin Topik Hidayat Utari Akhir Gusti Vivit Nurhikmah Havita Wahyu Rimbun Wawan Setiawan Weni Rahmadani Widi Purwianingsih Winda - Yusefni Winny Liliawati Wulandari, Melyastuti Yanti Hamdiyati Yanti Hamdiyati Yeni Setyowati*