cover
Contact Name
Munirah Tuli
Contact Email
munirahtuli@ung.ac.id
Phone
+6281294614208
Journal Mail Official
jppt@apps.ipb.ac.id
Editorial Address
-
Location
Kota bogor,
Jawa barat
INDONESIA
Journal of Marine Research
ISSN : -     EISSN : 24077690     DOI : 10.14710/jmr.v9i4.28340
Core Subject : Agriculture, Social,
The Journal of Tropical Fisheries Management is managed by the Department of Water Resource Management, Faculty of Fisheries and Marine Sciences, Bogor Agricultural University aims to publish the results of basic, applied research in the scope of fisheries resources, fish stock studies, and population dynamics, fish biodiversity, fisheries technology, industrialization and fish trade, fisheries management, and fisheries development policies in the tropics, especially Indonesia. The scope of the area includes: Marine Fisheries Coastal Fisheries Inland Fisheries The focus and scope of this publication are expected to contribute thoughts for the government to strengthen the science of fisheries management
Articles 500 Documents
Jenis Fitoplankton di Perairan Sekitar PLTU Tambak Lorok Semarang Clarence Daffa Ananta; Ria Azizah Tri Nuraini; Ibnu Pratikto
Journal of Marine Research Vol 10, No 1 (2021): Journal of Marine Research
Publisher : Departemen Ilmu Kelautan, Fakultas PerikanJurusan Ilmu Kelautan, Universitas Diponegoro

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (357.467 KB) | DOI: 10.14710/jmr.v10i1.27790

Abstract

Salah satu pemanfaatan lingkungan pesisir dan laut adalah pembangunan Pembangkit Listrik Tenaga Uap (PLTU), karena sistem penyediaan air yang dibutuhkan untuk operasional PLTU berasal dari air laut. Kenaikan suhu permukaan laut akibat adanya aktivitas PLTU akan mempengaruhi organisme pada perairan tersebut, salah satunya adalah fitoplankton. Fitoplankton merupakan organisme autotroph yang mengandung pigmen klorofil sehingga dapat melakukan proses fotosintesis dengan memanfaatkan cahaya matahari. Tujuan penelitian ini adalah untuk mengkaji komposisi dan kelimpahan fitoplankton di perairan sekitar PLTU Tambak Lorok Semarang. Metode yang digunakan dalam penelitian ini adalah metode deskriptif eksploratif, sedangkan dalam pengambilan sampel penelitian, digunakan metode purposive sampling. Hasil kelimpahan fitoplankton secara keseluruhan di Perairan Tambak Lorok, yang tertinggi terdapat pada stasiun 3 dengan jumlah sebesar 4035,7 Ind/L sedangkan pada stasiun 2 dengan jumlah sebesar 2812,7 Ind/L dan kelimpahan terendah terdapat pada stasiun 1 dengan jumlah sebesar 1494,7 Ind/L. Terjadi kenaikan suhu sebesar 5OC dengan nilai suhu mencapai 36,2OC pada stasiun 1 yang memiliki jarak 300 m dari titik outfall, suhu kemudian mengalami penurunan sebesar 3 OC dengan nilai suhu sebesar 33,7OC pada stasiun 2, dan terjadi penurunan pada stasiun 3 hingga nilai suhu sebesar 32,8OC dimana suhu sudah mendekati nilai normal suhu perairan sebesar 31 OC. Dapat disimpulkan bahwa nilai kelimpahan fitoplankton mengalami penurunan seiring dengan meningkatnya kenaikan suhu permukaan laut pada Perairan Tambak Lorok Semarang.One of the utilization of coastal and ocean environment is the development of electric steam power plant since the water required for the operational comes from seawater. The disposal location of the used seawater is in the form of waste heat, streamed into the ocean; therefore it caused the rise of sea-level temperature. The rising sea level temperature will affect the organism on those waters; one of them is phytoplankton. Phytoplankton is an autotroph organism that contains chlorophyll pigment so it can do photosynthesis process using the sunlight. This research aims to study the abundance of phytoplankton in waters around electric steam power plant Tambak Lorok Semarang. The method used in this research is the explorative, descriptive method, while the sampling method is purposive sampling. The highest phytoplankton abudance in Tambak Lorok Waters is located on the third station with 4035,7 Ind/L, while on the second station is 2812,7 Ind/L and the lowest abundance is on the first station with only 1494,7 Ind/L. The increase of sea-level temperature is up to 5OC with the temperature value reached 36,2OC on the first station that located 300 m from the power plant outfall. The temperature then drops 3OC with the value of 33,7OC on the second station. The temperature then drops on the third station with the value of 32,8OC where it’s closed to average sea level temperature, which is 31OC. It can be concluded that the abundance of phytoplankton decreased along with the increase of sea level temperature in Tambak Lorok Waters.
Analisis P/b Rasio Foraminifera di Perairan Delta Wulan, Demak, Jawa Tengah Bifa Aulia Manuhuwa; Retno Hartati; Hadi Endrawati
Journal of Marine Research Vol 10, No 1 (2021): Journal of Marine Research
Publisher : Departemen Ilmu Kelautan, Fakultas PerikanJurusan Ilmu Kelautan, Universitas Diponegoro

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (171.376 KB) | DOI: 10.14710/jmr.v10i1.27883

Abstract

Foraminifera merupakan organisme uniseluler yang dapat berperan sebagai indikator lingkungan serta dapat menentukan lingkungan pengendapan. Cara hidup foraminifera dibagi menjadi dua yaitu foraminifera planktonik (melayang) dan foraminifera bentonik (menambat). Peran foraminifera sebagai organisme indikator ideal karena memiliki siklus hidup relatif singkat sehingga memfasilitasi peristiwa rekaman episodik (Haunold et al., 1997). Saat ini foraminifera banyak hidup di perairan laut dangkal dan laut dalam seperti di Delta Wulan, Demak. Litologi penyusun Delta Wulan ini masih berupa endapan sedimen yang dapat diketahui bahwa delta ini berumur Kuarter. Sehingga, persentase P/b Rasio dapat digunakan untuk menganalisis lingkungan pengendapan (Grimsdale dan Morkhoven, 1955). Tujuan dari penelitian ini adalah untuk menentukan komposisi foraminifera dan P/b rasio sebagai indikator lingkungan pengendapan. Penelitian ini dilaksanakan pada bulan Januari dan Maret 2019 di perairan Delta Wulan, Demak. Metode yang digunakan dalam penelitian ini adalah metode survei eksploratif. Pengambilan sampel dilakukan secara purposive sampling dengan menetapkan 12 titik penelitian. Berdasarkan hasil penelitian ditemukan 24 genus foraminifera yang dikelompokkan menjadi 4 kelas, yaitu Globothalamea, Fusulinata, Tubothalamea dan Nodosariata. Nilai kelimpahan untuk foraminifera planktonik berkisar 57-8000 ind/m2sedangkan foraminifera bentonik berkisar 29-314 ind/m2. Nilai P/b Rasio berkisar antara 86 – 93% dengan kategori batimertri batial atas.Foraminifera is an unicellular organism that can act as an environmental indicator and can determine the depositional environment. The way of life of foraminifera is divided into two namely planktonic foraminifera (floating) and bentonic foraminifera (tethering). The role of foraminifera as an ideal indicator organism because it has a relatively short life cycle thus facilitating episodic recording events (Haunold et al., 1997). At present many foraminifera live in shallow and deep sea waters such as the Wulan Delta, Demak. This Wulan Delta lithology is still in the form of sediment deposits which can be seen that this delta is Quaternary age. Thus, the percentage P/b ratio can be used to analyze the depositional environment (Grimsdale and Morkhoven, 1955). The purpose of this research is to determine the composition of foraminifera and P/b ratio as indicators of depositional environment. This research was conducted in January and March 2019 in the waters of Delta Wulan, Demak. The method used in this research is explorative survey method. Sample was collected by using purposive sampling and deciding 12 research sites. Based on the results of the study found 24 genus foraminifera which are grouped into 4 classes, namely Globothalamea, Fusulinata, Tubothalamea and Nodosariata. The abundance value for planktonic foraminifera ranges from 57-8000 ind/m2 while the bentonic foraminifera ranges from 29-314 ind/m2. The value of P/b Ratio range from 86 - 93% with the upper batial bathymetry category.
Kajian Tingkat Kerentanan Rajungan (Portunus pelagicus) di Perairan Desa Tunggulsari Kabupaten Rembang Parameswari Iccha Nirmalabuddhi Wishnuputri; Sri Redjeki; Retno Hartati
Journal of Marine Research Vol 10, No 1 (2021): Journal of Marine Research
Publisher : Departemen Ilmu Kelautan, Fakultas PerikanJurusan Ilmu Kelautan, Universitas Diponegoro

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (296.834 KB) | DOI: 10.14710/jmr.v10i1.28247

Abstract

Rajungan (Portunus pelagicus) adalah salah satu sumber daya hayati laut Indonesia. Rajungan merupakan komoditas utama  perikanan di Indonesa, baik untuk lokal maupun ekspor. Nilai ekonomis rajungan yang tergolong tinggi mengakibatkan penangkapan rajungan dilakukan secara besar-besar dan dapat memicu terjadinya kepunahan. Penelitian bertujuan untuk mengetahui tingkat kerentanan rajungan di Perairan Desa Tunggulsari dan mengetahui karakteristik morfometri dari rajungan yang ditangkap pada lokasi tersebut. Metode yang digunakan dalam penelitian ini adalah metode Productivity and Susceptibility Analysis (PSA). Wawancara dilakukan kepada 60 nelayan di Desa Tunggulsari. Pengukuran parameter kualitas perairan meliputi suhu, oksigen terlarut, salinitas, dan pH. Pengukuran morfometri dilakukan pada salah satu pengepul di desa. Hasil dari wawancara diketahui bahwa nelayan di Desa Tunggulsari menggunakan 2 macam alat tangkap yaitu bubu lipat dan jaring insang dasar. Penilaian atribut produktivitas rajungan masuk dalam kategori tinggi, sedangkan penilaian atribut kerentanan tergolong pada resiko rendah untuk penggunaan kedua alat tersebut. Nilai MSC untuk alat tangkap bubu lipat adalah 96,0 dan 98,2 untuk alat tangkap jaring insang dasar. Nilai MSC > 80 menunjukkan bahwa tingkat kerentanan rajungan pada lokasi tersebut masuk pada kategori rendah. Selanjutnya, pola pertumbuhan rajungan di Desa Tunggulsari adalah allometrik negatif baik untuk rajungan jantan maupun betina. Hal ini menunjukkan pertumbuhan panjang dan lebar karapas lebih cepat dibandingkan penambahan berat rajungan. The blue swimming crab (Portunus pelagicus) is one of the Indonesian marine biological resources. The blue swimming crab is a main commodity of fisheries in Indonesia, both for local and export. Economic value of blue swimming crab classified as high involve over-exploitation of blue swimming crab and can lead to extinction. This research is aimed to determine level of vulnerability of blue swimming crab in Tunggulsari waters and to discover morphometry characteristic of blue swimming crab that caught at that location. The method used in this research is Productivity and Susceptibility (PSA) method. Interviews were conducted with 6 fishermen in the village of Tunggulsari. Measurement of water quality parameters including temperature, dissolved oxygen, salinity, and pH. Morphometry measurement was carried out in one of the collectors in the village. The results of the interview revealed that fishermen in the village of Tunggulsari used 2 fishing tools namely bubu lipat and bottom set gillnet. Assessment of blue swimming crab productivity attributes is included in the high category, while the assessment of vulnerability attributes is classified as low risk for the use of both tools. The MSC value for bubu lipat is 96,0 and 98,2 for bottom set gillnet. The MSC value is more than 80 indicates that the level of blue swimming crab vulnerability at that location is in the low category. Further, blue swimming crab growth pattern in the village of Tunggulsari are negative allometrics for both male and female blue swimming crabs. This shows the growth in length and width carapace is faster than the addition of blue swimming crab weight.
Kondisi Padang Lamun di Perairan Teluk Awur Jepara Terkait dengan Parameter Lingkungan Perairan dan Keberadaan Sampah Makro Plastik Hendra Kurniawan; Bambang Yulianto; Ita Riniatsih
Journal of Marine Research Vol 10, No 1 (2021): Journal of Marine Research
Publisher : Departemen Ilmu Kelautan, Fakultas PerikanJurusan Ilmu Kelautan, Universitas Diponegoro

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (289.738 KB) | DOI: 10.14710/jmr.v10i1.28266

Abstract

Ekosistem padang lamun merupakan salah satu ekosistem di wilayah pesisir yang mempunyai peranan yang penting untuk menjaga kelestarian dan keanekaragaman organisme laut. Kondisi parameter perairan pesisir merupakan faktor penting terhadap kondisi padang lamun yang meliputi  kecerahan perairan, pasang surut, arus, gelombang, suhu, salinitas, DO, kadar BOT dan pencemaran. Penelitian ini bertujuan untuk melihat pengaruh kondisi oseanografi dan sampah makro plastik terhadap kondisi padang lamun di perairan Teluk Awur Jepara yang dilakukan pada 3 stasiun pengamatan. Hasil penelitian menunjukkan bahwa bahwa tipe pasang surut di lokasi pengamatan adalah mixed tide prevailing semi durnal. Kisaran data kecerahan 30-40 cm, kisaran kecepatan arus antara 0,109-0,0154 m/det, tinggi gelombang  0,5-126 cm, suhu 28-30 0c, salinitas  34-35%, kisaran kadar DO 4,2-4,9 ppm, dan kisaran kadar BOT 9,9-11,9 mg/liter. Kisaran berat sampah yang di temukan 0,08 kg- 1,8 kg di seluruh stasiun. Kisaran prosentase penutupan lamun  seluruh stasiun 14,678% - 20,706%, hal ini menunjukan bahwa kondisi padang lamun di perairan Teluk Awur dalam kondisi tidak sehat (>25%). Seagrass ecosystem is one of the ecosystems in coastal areas that has an important role to maintain the sustainability and diversity of marine organisms. The condition of coastal water parameters is an important factor for seagrass conditions including waters brightness, tides, currents, waves, temperature, salinity, DO, BOT levels and pollution. This study aims to look at the effect of oceanographic conditions and macro plastic waste on seagrass conditions in the waters of Teluk Awur Jepara conducted at 3 observation stations. The results showed that the tidal type at the observation site was mixed tide prevailing semi durnal. Brightness data range is 30-40 cm, current speed range is between 0.109-0.0154 m / sec, wave height is 0.5-126 cm, temperature is 28-30 0c, salinity is 34-35%, DO content range is 44,2-4,9ppm, and the range of BOT levels 9.9-11.9 mg / liter. The range of waste weight found was 0.08 kg - 1.8 kg at all stations. The range of seagrass closure percentage for all stations is 14.678% - 20.706%, this shows that the condition of seagrass in waters of Teluk Awur Jepara is in an unhealthy condition (>25%).
Stok Karbon pada Ekosistem Lamun di Pulau Kemujan dan Pulau Bengkoang Taman Nasional Karimunjawa Septiyani Kusuma Dewi; Wilis Ari Setyati; Ita Riniatsih
Journal of Marine Research Vol 10, No 1 (2021): Journal of Marine Research
Publisher : Departemen Ilmu Kelautan, Fakultas PerikanJurusan Ilmu Kelautan, Universitas Diponegoro

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (272.66 KB) | DOI: 10.14710/jmr.v10i1.28273

Abstract

Lamun memiliki kemampuan menyimpan karbon di dalam biomassanya. Penelitian ini bertujuan untuk mengetahui nilai estimasi simpanan karbon dalam biomassa pada vegetasi lamun di Pulau Kemujan serta Pulau Bengkoang, Taman Nasional Karimunjawa. Pengambilan data menggunakan metode purposive sampling dan metode Seagrass Watch dengan mempertimbangkan kondisi lamun di lokasi tersebut. Pengukuran estimasi karbon dilaksanakan di Laboratorium Ilmu dan Nutrisi Pakan FPP Undip menggunakan metode Loss on Ignition dengan prinsip pengabuan. Jenis lamun yang ditemukan di Pulau Kemujan yaitu Enhalus acoroides, Thalassia hemprichii, dan Cymodocea serrulata, dan pada Pulau Bengkoang ditemukan lamun jenis Thalassia hemprichii, Cymodocea rotundata, Halophila ovalis, dan Enhalus acoroides. Nilai biomassa bawah substrat dan atas substrat pada Stasiun I Pulau Kemujan (3104,5 gbk/m2 dan 1868 gbk/m2) menunjukkan nilai yang lebih besar dibandingkan nilai biomassa bawah substrat dan atas substrat pada Stasiun II Pulau Bengkoang (714,25 gbk/m2 dan 534,25 gbk/m2). Nilai estimasi simpanan karbon pada Stasiun I yaitu 138,47 – 1533,28 gC/m2 dan pada Stasiun II yaitu 17,02– 498,31 gC/m2. Mayoritas nilai karbon lebih tinggi pada jaringan lamun bawah substrat.  Nilai estimasi simpanan karbon sedimen pada Stasiun I yaitu 52,60–339,81 gC/m2 dan 86,85–1329,08 gC/m2 pada Stasiun II. Penelitian ini dapat memberikan informasi mengenai fungsi lain ekosistem lamun yaitu sebagai penyerap karbon sehingga dapat dijadikan edukasi kepada masyarakat umum untuk melestarikan ekosistem lamun sebagai ekosistem yang dapat berperan penting dalam mengatasi masalah emisi gas rumah kaca dan pemanasan global. Seagrass have ability to store carbon mass in their biomass. The aim of this research is to find out the value of carbon stock on seagrass biomass in Kemujan Island and Bengkoang Island seagrass vegetation. The research was retrieval in purposive sampling method and collected seagrass vegetation data by using Seagrass Watch. Measurement of carbon stock estimation held  in INP FPP Undip Laboratory by using Loss on Ignition method. The type of seagrass found in Kemujan Island were Enhalus acoroides, Thalassia hemprichii, and Cymodocea serrulata, meanwhile in Bengkoang Island there were found Thalassia hemprichii, Cymodocea rotundata, Halophila ovalis, and Enhalus acoroides. The value of below ground and above ground biomass in Station I Kemujan Island (3104,5 gbk/m2 dan 1868 gbk/m2) is higher than the value of below ground and above ground biomass in Station II Bengkoang Island (714,25 gbk/m2 and 534,25 gbk/m2). Carbon stock estimation value in Station I is 138,47–1533,28 gC/m2  and 17,02–498,31 gC/m2 in Station II. Most of carbon stock value is higher in below ground seagrass tissue. The value of carbon stock estimation of sediment in Station I is 52,60–339,81 gC/m2 and 86,85–1329,08 gC/m2 in Station II. The research gives information about another function of seagrass, as carbon absorber and can be as education for public to conserve seagrass ecosystem and has important role in resolving greenhouse gas emission and global warming.
Identifikasi Molekuler Kapang Asosiasi Spons menggunakan Metode DNA Barcoding Stefanie Jessica Henny Larasati; Agus Sabdono; Mada Triandala Sibero
Journal of Marine Research Vol 10, No 1 (2021): Journal of Marine Research
Publisher : Departemen Ilmu Kelautan, Fakultas PerikanJurusan Ilmu Kelautan, Universitas Diponegoro

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (361.161 KB) | DOI: 10.14710/jmr.v10i1.28334

Abstract

Spons merupakan organisme yang memiliki pori-pori dan termasuk kedalam filum Porifera. Hewan ini merupakan filter feeders dimana spons menyaring makanannya masuk kedalam rongga tubuhnya, sehingga spons dapan memakan partikel organik algae, dan mikroba, termasuk kapang. Kapang merupakan mikroorganisme eukariotik dari kingdom fungi, multiseluler, menghasilkan miselium tanpa pembentukan badan buah. Kapang dapat berfungsi sebagai penjaga keseimbangan ekosistem di perairan. Tujuan dari penelitian ini adalah mengidentifikasi dua isolat kapang yang telah diisolasi dari inang spons di ekosistem mangrove dengan menggunakan DNA barcoding. Metode dalam penelitian ini yaitu peremajaan isolat, karakterisasi morfologi yaitu warna koloni, tekstur, reverse, exudates, sclerotia, bentuk konidia, konidiofor, spora, dan septa. Identifikasi molekuler dari ekstraksi DNA, amplifikasi, elektroforesis, visualisasi DNA, sekuens dan BLAST. Optimasi suhu annealing dilakukan pada amplifikasi DNA. Berdasarkan identifikasi molekuler dengan menggunakan primer universal ITS1 5' TCCGTAGGTGAACCTGCGG 3' dan ITS4 5' TCCTCCGCTTATTGATATGC 3' dan persamaan homologi, isolat MKMS 2.1 merupakan Trichoderma reesei (100%) dan PKMS 2.2 merupakan spesies Fusarium solani (99,81%). A sponge is an organism that has pores and belongs to the Porifera phylum. These animals are filter feeders where the sponge filters its food into the body cavity, so the sponge can eat organic algae particles, and microbes, including fungi. Mold is a eukaryotic microorganism from Fungi kingdom, multicellular, that forms mycelium without fruiting body formation. Mold has an important role in balancing the environmental quality in an ecosystem. The purpose of this study was to identify two molds that had been isolated from sponge in the mangrove ecosystem using DNA barcoding. The study was conducted in April-October 2019 in Laboratory of Tropical Marine Biotechnology using the experimental laboratory method. The methods in this research were isolation refreshment, morphological characterization which were consisted of colony color, texture, reverse, exudates, sclerotia, conidia, conidiophores, spores, and septa. Molecular identification consisted of DNA extraction, amplification, electrophoresis, DNA visualization, sequences and BLAST. Annealing temperature optimization is carried out on DNA amplification. Based on molecular identification using universal primers ITS1 5 'TCCGTAGGTGAACCTGCGG 3' and ITS4 5 'TCCTCCGCTTATTGATATGC 3' and homological equations, MKMS 2.1 isolates were identified as Trichoderma reesei (100%) and PKMS 2.2 were identified as Fusarium solani (99.81%).
Perubahan Lahan Mangrove di Pesisir Muara Gembong, Bekasi, Jawa Barat Alin Maulani; Nur Taufiq-SPJ; Ibnu Pratikto
Journal of Marine Research Vol 10, No 1 (2021): Journal of Marine Research
Publisher : Departemen Ilmu Kelautan, Fakultas PerikanJurusan Ilmu Kelautan, Universitas Diponegoro

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (532.417 KB) | DOI: 10.14710/jmr.v10i1.28396

Abstract

Kecamatan Muara Gembong adalah wilayah dengan ekosistem mangrove yang cukup luas dan tersebar. Mangrove adalah kelompok jenis tumbuhan yang tumbuh di sepanjang garis pantai tropis sampai subtropis di suatu lingkungan yang mengandung garam dan bentuk lahan berupa pantai dengan reaksi tanah anaerob. Kondisi ekosistem mangrove sangat peka terhadap gangguan dari luar terutama dari kegiatan pencemaran, konversi hutan mangrove menjadi kawasan non-hutan, ekploitasi hasil mangrove yang berlebihan sehingga terjadi dinamika pada luasan lahannya. Perubahan yang terjadi pada ekosistem mangrove ini dapat berupa penambahan, pengurangan, dan lahan yang tetap. Metode yang dilakukan pada penelitian ini berupa pengolahan data satelit citra Sentinel 2A, Landsat 8, dan Landsat 5 untuk menganalisa sebaran mangrove pada tahun 2009, 2014, dan 2019, serta perubahan yang terjadi. Validasi data dilakukan dengan pengamatan kawasan langsung di lokasi penelitian berdasarkan pengolahan data yang telah dilakukan. Hasil pengolahan data menunjukan di Kecamatan Muara Gembong pada tahun 2009-2019 diketahui terjadi penambahan luasan lahan mangrove sebesar 1017,746 ha dan pengurangan luasan mangrove sebesar 275,37 ha. Selain itu, terdapat pula lahan mangrove yang tetap bertahan pada kurun waktu 2009-2019 seluas 255,057 ha. Sehingga perubahan lahan mangrove yang terjadi di Kecamatan Muara Gembong cenderung mengalami pertambahan luasan lahan mangrove, yaitu sebesar 66% lahan mangrove yang bertambah. Muara Gembong Subdistrict is an area with a wide and scattered mangrove ecosystem. Mangroves are a group of plant species that grow along tropical to subtropical coastlines in an environment that contains salt and landforms in the form of beaches with anaerobic soil reactions. The condition of mangrove ecosystems is very sensitive to outside disturbances, especially from pollution activities, conversion of mangrove forests to non-forest areas, excessive exploitation of mangrove products resulting in dynamics in the area of land. Changes that occur in this mangrove ecosystem can be in the form of addition, subtraction, and permanent land. The method used in this research is the processing of Sentinel 2A, Landsat 8, and Landsat 5 satellite image data to analyze the distribution of mangroves in 2009, 2014 and 2019, and the changes that occur. Data validation is done by direct observation of the area at the research location based on data processing that has been done. The results of data processing showed that in Muara Gembong Subdistrict in 2009-2019 it was known that there was an increase in the area of mangrove land by 1017, 746 ha and reduction in mangrove area by 275.37 ha. In addition, there are also mangrove lands that have survived in the period 2009-2019 covering 255,057 ha. So that changes in mangrove land that occur in Muara Gembong District tend to experience an increase in the area of mangrove land, which is equal to 66% of the mangrove land that is increasing.
Kesuburan Perairan Berdasarkan Kandungan Nutrien pada Ekosistem Mangrove Desa Bedono, Demak Aufa Rifqi Widiardja; Ria Azizah Tri Nuraini; Diah Permata Wijayanti
Journal of Marine Research Vol 10, No 1 (2021): Journal of Marine Research
Publisher : Departemen Ilmu Kelautan, Fakultas PerikanJurusan Ilmu Kelautan, Universitas Diponegoro

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (315.69 KB) | DOI: 10.14710/jmr.v10i1.28480

Abstract

Nutrien memiliki peranan penting dalam pertumbuhan dan perkembangan biota laut dan merupakan hasil uraian dari bahan organik kompleks. Secara alamiah konsentrasi nutrien dalam perairan bervariasi dan dalam kondisi tertentu dapat terjadi keadaan di luar batas optimal bagi organisme. Penelitian ini bertujuan untuk mengetahui kandungan nutrien (Nitrat, Nitrit, Ammonium dan Phosphat) dan mengetahui tingkat kesuburan perairan Desa Bedono, Kecamatan Sayung, Kabupaten Demak sehingga dapat memberikan informasi dan acuan dalam memonitoring kandungan nutrient di perairan. Penelitian ini dilaksanakan pada bulan Januari 2020 di Perairan Desa Bedono, Kecamatan Sayung, Kabupaten Demak. Metode dalam penelitian ini adalah metode deskriptif sedangkan pemilihan lokasi pengambilan sampel menggunakan metode purposive sampling method. Pengambilan parameter lingkungan yang dibutuhkan dilakukan secara insitu dan sampel air di analisis di Laboratorium Teknik Lingkungan, Universitas Diponegoro. Pengambilan sampel dilakukan tiga kali pengulangan dengan menyimpan sampel air dengan botol sampel polyetilene yang dimasukan kedalam coolbox untuk menghindari masuknya sinar matahari. Hasil penelitian menunjukan nilai analisis kandungan nitrat pada perairan Desa Bedono, Kabupaten Demak berkisar antara 2,353 – 2,973 mg/L. Kandungan nitrit berkisar antara 0 – 0,01 mg/L, kandungan ammonium berkisar antara 14,815 – 18,239 mg/L, sedangkan kandungan phospat berkisar antara 0,04767 – 0,05133 mg/L. Berdasarkan kandungan nutrient Nitrat dan Phosphat kesuburan perairan berada dalam klasifikasi mesotrofik.Nutrient had an important role in growth and development of organism and are result of the decomposition from complex organic materials. Naturally, the concentration of nutrients in the water varies and under certain conditions it can occur outside the optimal limits that was declared safe for organism. This research aims to determine the level of water fertility based on the content of nitrate, nitrite, ammonium and phosphate in the Coastal Waters Of Bedono Village, Sayung District, Regency of Demak. This research was conducted on January 2020 in the Coastal Waters Of Bedono Village, Sayung District, Regency of Demak. The method used in this research is descriptive method while the selection of sampling location used the purposive sampling method. Taking the required environmental parameters conducted in situ and sample analysis conducted at Laboratorium Teknik Lingkungan, Universitas Diponegoro. Sampling is done by storing water samples with polyetilene bottles to avoid the entry of sunlight in three repetitions. The result of this research shows that the average  range value of Nitrate content analysis at location is 2,353 – 2,973 mg/L. The average range value of nitrite content 0 – 0,01 mg/L, for the average range value of ammonium content is 14,815 - 18,239 mg / L, while the phosphate content ranged from 0.4767 - 0.05133 mg / L. Based on the nutrient content of nitrate and phosphate fertility waters at the level mesotrophic.
Uji Organoleptik pada Pengaruh Penambahan Rumput Laut Kappaphycus alvarezii (Doty, 1985) Florideophyceae: Solieriaceae dan Gracillaria verrucosa (Hudson, 1950) Rhodophyceae: Gracilariaceae Terhadap Produk Mie Suket Segoro Lailatul Atiqoh; AB Susanto; Gunawan Widi Santosa
Journal of Marine Research Vol 10, No 1 (2021): Journal of Marine Research
Publisher : Departemen Ilmu Kelautan, Fakultas PerikanJurusan Ilmu Kelautan, Universitas Diponegoro

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (171.157 KB) | DOI: 10.14710/jmr.v10i1.28494

Abstract

Mie merupakan suatu jenis makanan hasil olahan tepung yang sudah dikenal dan digemari oleh sebagian besar masyarakat Indonesia. Rumput laut K. alvarezii merupakan rumput laut penghasil karaginan (karigenofit)danG. verrucosa merupakan rumput laut penghasil agar (agarofit).Penelitian ini bertujuan untuk mengetahui pengaruh untuk mengetahui pengaruh penambahan rumput laut terhadap karakteristik sifat fisik mie (gel strength) dan penerimaannya dalam masyarakat, meliputi kesukaan terhadap tekstur, rasa, aroma, warna, dan kenampakan mie.Penelitian dilakukan secara eksperimental menggunakan rancangan acak lengkap (RAL) dengan 7 perlakuan dan 4 ulangan dengan perbedaan konsentrasi penambahan rumput laut segar yakni: Kontrol (karagenan + terpung terigu), A (K.alvarezii + karagenan + terpung terigu),B (G.verrucosa + karagenan + tepung terigu). Kemudian dilakukan uji organoleptik yang meliputi tekstur, warna, rasa dan aroma produk mie. Hasil penelitian menunjukkan bahwa uji organoleptik terhadap tekstur mie yang paling disukai yaitu pada perlakuan A2 (4,30), dan yang tidak disukai yaitu padaperlakuan B3 (3,27). Rasa yang paling disukai yaitu perakuan A2 (3,74) dan yangtidak disukai pada perlakuan B3 (2,64). Aroma yang paling disukai yaitu pada perlakuan A3 (3,63) dan yang tidak disukai yaitu pada perlakuan B1 (2,71). Warna yang paling disukai yaitu pada perlakuan B3 (3,67) dan yang tidak disukai yaitu perlakuan A2 (3,53). Kenampakan yang paling disukai yaitu pada mie dengan perlakuan A3(3,80) dan yang tidak disukai yaitu pada perlakuan B3 (3,54 Hasil dari ANOVA gel strength menunjukkan bahwa penambahan rumput laut berpengaruh nyata terhadap sifat fisik mie P<0.05). Noodle is a type of processed food that is well-known and favored by most Indonesian people. K. alvarezii seaweed is a carrageenan-producer seaweed (carregenophyte) and G. verrucosa is agar-producer seaweed (agarophyte). This study aims to determine the effect of the addition of seaweed to the characteristics of the physical properties of noodles (gel strength) and its acceptance in community, including preference for texture, taste, scent, color, and appearance of noodles. The research was conducted experimentally using a completely randomized design (CRD) with 7 treatments and 4 replications with different concentrations of fresh seaweed addition namely: Control (carrageenan + wheat flour) , A (K. alvarezii + carrageenan + wheat flour), B (G.verrucosa + carrageenan + wheat flour). Then the organoleptic test was performed which included the texture, color, taste and aroma of the noodle product. The results showed that the most preferred organoleptic test on the texture of noodles was in the treatment A2 (4.30), and the one that was disliked was the B3 treatment (3.27). The most preferred flavor is rooting A2 (3.74) and which is not preferred in B3 treatment (2.64). The most preferred scent was in treatment A3 (3.63) and the one that was disliked was in treatment B1 (2.71). The most preferred color is the B3 treatment (3.67) and the least preferred one is the A2 treatment (3.53). The most preferred appearance was noodles with A3 treatment (3.80) and the undesirable one was on B3 treatment (3.54 results from ANOVA gel strength showed that the addition of seaweed significantly affected the physical properties of noodles P <0.05).
Aspek Biologi Pari Kekeh (Rhynchobatus sp. (Rhinidae:Chondrichthyes)) Studi Kasus di PPN Brondong, Lamongan Lara Azidha; Irwani Irwani; Munasik Munasik
Journal of Marine Research Vol 10, No 1 (2021): Journal of Marine Research
Publisher : Departemen Ilmu Kelautan, Fakultas PerikanJurusan Ilmu Kelautan, Universitas Diponegoro

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (280.576 KB) | DOI: 10.14710/jmr.v10i1.28496

Abstract

Pari kekeh (Rhynchobatus sp.) adalah organisme laut yang tergolong dalam Subkelas Elasmobranchii dan dikelompokkan ke dalam Kelas Chondrichthyes. Pari kekeh sering ditangkap dikarenakan dagingnya memiliki rasa yang enak, Selain itu, sirip Pari kekeh memiliki harga yang mahal  di China dan Global. Pari kekeh telah masuk kedalam daftar IUCN red list kategori critically endangered akibat eksploitasi berlebihan. Hal ini apabila terus terjadi maka ketersedian sumber daya Pari kekeh di habitatnya terancam punah. Oleh karena itu, perlu adanya pengaturan agar tidak terjadi eksploitasi berlebihan yang berdampak pada populasi pari kekeh, salah satunya dengan melakukan analisis aspek biologi. Tujuan dari penelitian ini untuk mengetahui hubungan panjang berat, nisbah kelamin, tingkat kematangan gonad, ukuran pertama kali matang gonad dan fekunditas Pari kekeh yang didaratkan di PPN Brondong. Sampel yang digunakan yaitu pari kekeh sebanyak 160 ekor. Penelitian ini menggunakan metode deskriptif dengan mengukur data panjang total dan standar, bobot, pengamatan gonad. Pola pertumbuhan Pari kekeh yaitu allometrik negatif (b = 2,52). Nisbah kelamin = 0,625 (Chi Square) dengan X tabel = 3,975, maka jumlah Pari jantan dan betina seimbang. Kematangan gonad Pari Rhynchobatus sp. sebesar 53%. Ukuran pertama kali matang gonad Pari kekeh jantan memiliki panjang total 48,97-49,16 cm dan Pari kekeh betina memiliki panjang total 95,29-98,60 cm. Nilai fekunditas Pari kekeh berkisar antara 5-16 butir pada kisaran panjang total tubuh 86-114 cm.  Kekeh Stingrays (Rhynchobatus sp.) are marine organisms that classified to the Elasmobranchii subclass and grouped into the Chondrichthyes Class. Kekeh Stingrays is often caught because has a good taste. In addition, Kekeh Stingrays fins have a high price in the Stingray and Shark fin trade in China and Global. Kekeh Stingrays has entered into the IUCN red list in the critically endangered category due to overexploitation. If excessive exploitation continues, the availability of Stingray resources in their habitat will be threatened. Therefore, there is a need for control to avoid overexploitation that affects the population of Kekeh Stingrays, one of which is by analyzing the biological aspects. The purpose of this study was to determine the length and weight correlation, sex ratio, gonad maturity level, size of the first gonad maturity, and fecundity of Kekeh Stingray which was landed in PPN Brondong. The samples used were 160 Kekeh Stingrays. This research uses descriptive method by measuring the total and standard length, weight, also gonad observations. The results obtained are the length and weight correlation of Stingray Kekeh which is negative allometric with a value of b = 2.52. The sex ratio based on Chi Square (x2) = 0,625 with X table = 3,975, that means the number of male and female Stingray is balanced. The value of  TKG II and TKG III of Rhinchobatus sp.that is, 53% is dominated by matured Rays. The first size of gonad maturity for rays was in a range 48,97-49,16 cm, while for female rays was in a range 95,29-98,60 cm. The Value of Kekeh Stingrays’s fecundity was around 5-16 eggs with the total length range is 86-114 cm.

Page 1 of 50 | Total Record : 500