Claim Missing Document
Check
Articles

Found 29 Documents
Search

DETERMINATION OF CALCIUM (Ca) AND MAGNESIUM (Mg) CONTENT IN CACAO (Theobroma cacao Linn) FERMENTATION AND NON FERMENTATION BY SPECTROPHOTOMETRY -, Wiranda; Syukur, Sumaryati; Aziz, Hermansyah
Jurnal Riset Kimia Vol 3, No 1 (2009): September
Publisher : Universitas Andalas

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.25077/jrk.v3i1.104

Abstract

 ABSTRACT Cacao beans contain many kinds of mineral, magnesium (Mg), calcium (Ca), Zinc (Zn), Phosphor (P) and etc. This study investigated magnesium (Mg) and calcium (Ca) in fermentation and non fermentation cacao beans by atomic absorption spectrophotometry. Mg and Ca, content in non fermentation cacao beans of green and red variety are 453 µg/g, 466 µg/g, and 491 µg/g, 445 µg/g. Mg and Ca, contents  in fermentation cacao beans of green and red variety are, 596 µg/g, 528 µg/g, and 554 µg/g, 505 µg/g. Fermentation make magnesium (Mg) and calcium (Ca) content increase significantly. Keywords : Theobroma cacao Linn, fermentation, spectrophotometry.
OPTIMASI NUTRISI MEDIA PERTUMBUHAN BAKTERI TERMOFIL PENGHASIL SELULASE DARI SUMBER AIR PANAS RIMBO PANTI -, Armaini; Dharma, Abdi; Syukur, Sumaryati; -, Jamsari
Jurnal Riset Kimia Vol 5, No 1 (2011): September
Publisher : Universitas Andalas

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.25077/jrk.v5i1.165

Abstract

 Optimization have been done on the media for the growth of the isolated thermophiles bacteria from hot springs Rimbo Panti, the nutrients comprising variety of carbon sources such as CMC (carboxymethyl cellulose), avicell (micro crystalline cellulose), and cellobiose, with a variety of sources organic nitrogen, peptone, extracts yeast, tryptone, and urea, as well as variations consist of inorganic nitrogen sources, KNO3, NaNO3, (NH4)2SO4, and (NH4)NO3. Determination of cellulase activity performed using DNS reagent (3,5-dinitro salicylic acid). Maximum cellulase production with high activity based on the results of this research, the best of carbon source is CMC with optimum concentration 0.125%, inorganic nitrogen source is peptone with the optimum concentration of 0.3 to 0.4% and the inorganic nitrogen source is (NH4)2SO4 with optimum concentration of 0.2 - 0.25%. Optimization of size of inoculums obtained the optimum amount of inoculums 2%. Keywords: Optimization, thermophiles bacteria, cellulose, carbon sources, nitrogen sources
POTENSI BAKTERI ASAM LAKTAT DALAM MENGHASILKAN BAKTERIOSIN SEBAGAI ANTIMIKROBA DAN PENGUKURAN BERAT MOLEKULNYA DENGAN SDS-PAGE DARI ISOLAT FERMENTASI KAKAO -, Urnemi; Syukur, Sumaryati; Purwati, Endang; Ibrahim, Sanusi; -, Jamsari
Jurnal Riset Kimia Vol 4, No 2 (2011): March
Publisher : Universitas Andalas

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.25077/jrk.v4i2.141

Abstract

 ABSTRACTLactic acid bacteria (LAB) were isolated from cocoa beans fermentation Forestero variety from West Sumatera, that were eleven isolates. The isolates were tested to antimicrobial activity against pathogenic bacteria E.coli NBRC 14237, Staphylococcus aureus NBRC 13276, Bacillus subtilis BTCCB 612, listeria m. dan S. Typhii.Results the research showed that, isolates had inhibition zone to pathogenic bacteria, that were 7 mm till 12 mm at 48 hours observation. R2.4 isolate was most potential to inhibition zones growth pathogenic bacteria, That was 11mm till 12 mm to five pathogens. R2.4 isolates was the highest to against pathogenic bacteria (Bacillus subtilis BTCCB, Listeria monocytogenesis and Staphylococcus aureus NBRC) had inhibition zones, that was 12. mm till 48 hours. Listeria monocytogenesis had been known as pest bacterium of food born, so that R2.4 isolate can be used as food biopreservative. Crude of R2.4 isolate molecular weight was 10 kDa by SDS-PAGE.  Key words: Lactic acid bacteria, antimicrobial activity, SDS-PAGE, cocoa fermentation  and food biopreservative    
SKRINING DAN IDENTIFIKASI BAKTERI PENDEGRADASI INULIN DARI SUMBER AIR PANAS PADANG BALIMBIANG DI SOLOK Azhar, Minda; Syukur, Sumaryati; Natalia, Dessy; -, Vovien; -, Jamsari
Jurnal Riset Kimia Vol 5, No 1 (2011): September
Publisher : Universitas Andalas

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.25077/jrk.v5i1.175

Abstract

 ABSTRACT Thermophilic bacteria and thermotolerant bacteria are potential sources of thermostable of inulin degradating enzyme, an enzyme which converts inulin into fructose and FOS prebiotics. Isolation and identification of 16S rDNA gene inulin degradation bacteria from hot springs of Padang Balimbiang in Solok have been undertaken. Screening of inulin degradation bacteria was done using direct and undirect methods on medium with inulin or inulin-RBB as a sole carbon source. One inulin degradation bacteria have been obtained from 21 isolates. The isolate was designated as UBCT-030. The isolate is able to grow at temperature 23 °C to 60 °C. According to 16S rDNA gene analysis, phisiology and morphology bacteria on UBCT-030 isolate was identified as Bacillus subtilis.  Keywords: inulinase bacteria, hot springs, Bacillus subtilis, inulin, 16S rDNA gene
UJI PREKLINIS VIRGIN COCONUT OIL TERHADAP PENINGKATAN KADAR KOLESTEROL BAIK HDL, PENURUNAN KADAR TRIGLISERIDA, PROFIL KIMIA ASAM LEMAK (C6-C18) DAN OMEGA-3 PADA SERUM DARAH TIKUS PUTIH (Mus musculus) Syukur, Sumaryati; Dahlyanti, Rina; Sumanti, Titi; Murni, Yulia; Hidayat, Zoni; Arifin, Helmi; Purwati, Endang; -, Risfaheri
Jurnal Riset Kimia Vol 1, No 1 (2007): September
Publisher : Universitas Andalas

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.25077/jrk.v1i1.79

Abstract

 ABSTRACT The Virgin Coconut Oil (VCO) products have different qualities and controversy effects of lipids metabolism. This research has been used one of VCO product that was produced by fermentation method using Lactobacillus sp. It has high amount of lauric acid (C12) up to 51 %, caprilic acid (C8) 8.9 %, capric acid (C10) 7 % include Omega-3, 6 and 9, vitamins A, D, E, K and three kinds of phytohormone. The ratio of Omega-3 and 6 was very proportional, therefore it is important to investigate the Pre Clinic Test of animal experiment. Pre Clinic Test of dietary VCO as food supplement has been determined by using 40 mice’s, which divided into 4 groups. Feeding on egg yolk to Group I (negative control), Group II (positive control) increased cholesterol level. The others were Group III (egg yolk and VCO 2 %) and group IV (egg yolk and VCO 4 %). It was determined the total of cholesterol, HDL at 10th, 20th and 30th day treated by using the enzymatic methods. The dietary of VCO 2-4 % resulted in significant increases in HDL levels from 32 % to 69 %. The dietary of VCO 4 % for four weeks did not toxic to mice metabolism. Triglycerides level decreased 50 % from 177 to 85 and similar resulted to cholesterol ratio. Feeding on VCO for 4 weeks, the SCFA and MCFA not detected in serum of mice. The LCFA (C16) palmitate in significant decreased from 0.96 to 0.1%. The significant level of Omega-3 increased more than three times in serum of mice dietary VCO 2-4 %.  Keywords: Coconut Oil, Lactobacillus
SKRINING DAN IDENTIFIKASI BAKTERI TERMOFILIK PENGHASIL SELULASE DAN AMILASE DARI SUMBER AIR PANAS BUKIT KILI SOLOK SUMATERA BARAT DENGAN ANALISIS GEN 16S rRNA Octarya, Zona; Syukur, Sumaryati; RN, Endang Purwati
Sistem Informasi Vol 2 No 1 (2011): Jurnal Photon
Publisher : Fakultas MIPA dan Kesehatan Universitas Muhammadiyah Riau

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (653.198 KB)

Abstract

Enzim termostabil dari bakteri termofilik merupakan enzim yang sangat potensial untuk mengatasi kendala teknis industri yang berhubungan dengan proses pada suhu tinggi. Salah satu sumber enzim adalah mikroorganisme termofilik yang banyak terdapat pada sumber air panas. Indonesia merupakan negara kepulauan yang banyak mempunyai sumber air panas, salah satunya adalah Kabupaten Solok. Penelitian ini mencakup skrining dan identifikasi bakteri penghasil enzim termostabil selulase dan amilase dari sumber air panas Bukit Kili Ketek di Kabupaten Solok. Suhu air panas adalah 52°C pada bulan Juni 2009 dan pH air adalah 8. Kultur murni yang diperoleh adalah sebanyak 22 kultur Dari hasil pewarnaan gram, diperoleh sebagian besar bakteri air panas adalah jenis bakteri streptobacilli (basilus) gram positif, hanya dua isolat yang merupakan gram negatif yaitu isolat S1B dan S5B. S2A adalah isolat yang mempunyai aktifitas selulase paling tinggi dibandingkan dari isolat yang lain karena mempunyai indeks zona bening selulase lebih tinggi yaitu 2,6. Isolat S2A juga menghasilkan amilase tinggi dengan indeks zona bening 2,5. Persen identitas bakteri air panas S2A yang diperoleh adalah 97% dengan Anoxybacillus flavithermus strain AE3.
TRANSFORMASI Agrobakterium rhizogenese DAN INDUKSI AKAR RAMBUT PADA TANAMAN KAKAO (Theobroma cacao) UNTUK PRODUKSI SENYAWA ANTIOKSIDAN SECARA INVITRO Syukur, Sumaryati; Aneloi N, Zozy; Putri, Femilya
Jurnal Riset Kimia Vol 2, No 2 (2009): March
Publisher : Universitas Andalas

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.25077/jrk.v2i2.156

Abstract

 ABSTRACT Transformation of Ri T-DNA Plasmid Agrobacterium rhizogenese to varieties Theobroma cacao variety TSH which is growing in west Sumatra and induction of hairy roots in order to produce bioflavonoid antioxidant compounds such as, catechin, polyfenol, or monomer and oligomer flavones was successfully obtained. Three spesies of A.rhizogenese (A4,LBA 9457 and ATTCC 15834) originaly from LIPI was used to transform Ri T-DNA plasmid in MS medium via cacao embryo culture. The aim of this paper is to determine the affectivity and ability of the three species of bacterial above to produce hairy roots in cacao invitro culture. The statistical methods RAL was uses with 4 time treatments and 6 time repeated experiments. As treatment was bacterial inoculation and without inoculation as a control. The transformation result shows 2 of 3 of bacterial species have ability to induce hairy roots of.T cacao embryos counting by percentages of explants with producing hairy roots 16.66% for A4, 83.33% for LBA 9547 spesies.qualitative test of polyfenol from hairy roots transformants give (+4) as compared to non transform only (+1). Cathechin compound was determined by spectrophotometer as much as 0.1% for non transform and 0.87 % for hairy roots transformants by LBA 9547. Conformation of plasmid Ri T-DNA hairy roots from two transformants was analysis by PCR methods. The two primers rol B1 (52ATGGATCCCAAATTGCTTCCCCCACGA32) dan rol B2 (53 TTAGG CTTTCATTCGGGTTTACTGCAGC 33) was used. For TR-DNA the primes used is TRI (53 GGAAATTGTGGCGTTGTTGTGGAC 3’) and  TR2 (5’ AATCGTTCAGAGAGCGTCCGA AGTT 3’) . PCR analysis of DNA electrophoresis founded the band of TL region at 780 bp and TR at 1600 bp using DNA Ledder as DNA standard.  Keywords : transformation A.rhizogenese, PCR, Theobroma cacao, kultur embrio, kultur akar rambut, metabolit sekunder, cathechin    
POTENSI BAKTERI ASAM LAKTAT DALAM MENGHASILKAN BAKTERIOSIN SEBAGAI ANTIMIKROBA DAN PENGUKURAN BERAT MOLEKULNYA DENGAN SDS-PAGE DARI ISOLAT FERMENTASI KAKAO -, Urnemi; Syukur, Sumaryati; Purwati, Endang; Ibrahim, Sanusi; -, Jamsari
Jurnal Riset Kimia Vol 1, No 2 (2008): March
Publisher : Universitas Andalas

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.25077/jrk.v1i2.149

Abstract

ABSTRACT Lactic acid bacteria (LAB) were isolated from of cocoa beans fermentation Forestero variety from West Sumatera, that were eleven isolates. The isolates were tested to antimicrobial activity against pathogenic bacteria E.coli NBRC 14237, Staphylococcus aureus NBRC 13276, Bacillus subtilis BTCCB 612, listeria m. dan S. Typhii. Results the research showed that, isolates had inhibition zone to pathogenic bacteria, that were 7 mm till 12 mm at 48 hours observation. R2.4 isolate was most potential to inhibition zones growth pathogenic bacteria, that was 11mm till 12 mm to five pathogens. R2.4 isolates was the highest to against pathogenic bacteria (Bacillus subtilis BTCCB, Listeria monocytogenesis and Staphylococcus aureus NBRC) had inhibition zones, that was 12.00 mm till 48 hours. Listeria monocytogenesis had been known as pest bacterium of food born, so that R2.4 isolate can be used as food biopreservative. Crude of R2.4 isolate molecular weight was 10 kDa by SDS-PAGE.  Key words: Lactic acid bacteria, Antimicrobial activity, SDS-PAGE, Cocoa fermentation and food biopreservative                                                      
ISOLASI BAKTERI PROBIOTIK PENGHASIL PROTEASE DAN LAKTASE DARI FERMENTASI KAKAO VARIETAS HIJAU Utami, Lidya Sari; Syukur, Sumaryati; ., Jamsari
CHEMISTRY PROGRESS Vol 5, No 2 (2012)
Publisher : Sam Ratulangi University

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.35799/cp.5.2.2012.775

Abstract

Bakteri asam laktat (BAL) merupakan salah satu mikroorganisme yang terlibat pada fermentasi kakao. Bakteri ini umumnya dapat dimanfaatkan sebagai probiotik yang memberikan keuntungan bagi manusia seperti, menghambat pertumbuhan bakteri patogen, menghasilkan berbagai enzim untuk kesehatan pencernaan, contohnya, laktase dan protease. Tujuan penelitian ini adalah untuk mengisolasi, dan mengidentifikasi bakteri probiotik protease dan laktase dari hasil fermentasi kakao, sehingga nantinya dapat dijadikan sebagai sumber probiotik baru yang dapat digunakan dibidang kesehatan dan industri. Pulp kakao difermentasi selama 36 jam, suhu kamar pada media MRS Broth dan MRS agar didapatkan enam isolat bakteri. Bakteri yang didapatkan diuji ketahanan terhadap pH asam (pH 2, 2.5 dan 3), dan didapatkan empat bakteri yang dapat hidup pada kondisi asam, yang kemudian digunakan untuk uji antimikroba terhadap Escherichia coli ATCC 25922 dan Salmonella thypi NBRC14237. Zona hambat yang dihasilkan keempat isolat bakteri tersebut termasuk pada golongan yang sangat kuat kuat (20 mM). Media TSIA (Triple Sugar Iron Agar) digunakan pada uji laktase, hanya dua isolat yang mampu menghasilkan laktase. Kedua isolat tersebut selanjutnya digunakan pada uji protease, didapatkan satu isolat (G6) memiliki zona bening terbesar (15mm). Kadar protease dari isolat G6 diukur dengan metode Lowry, dan didapatkan kadar protease maksimum adalah 0,88mg/mL pada waktu inkubasi 18 jam. Identifikasi genomik (16SrRNA) menggunakan primer 9F dan 1541R diketahui bahwa isolat G6 memiliki kesamaan 86% dengan Lactobacillus brevis strain FE.Lacticacid bacteria(LAB) is a microorganisms involved in thefermentation of cocoa. These bacteria generally used as probiotics, because it has manybenefits forhumans, such as inhibitingthe growth ofpathogenic bacteria, and produce variousenzymes, such as, lactaseandprotease. The goal of this studywas toisolatedandidentified the probioticbacteria producing proteaseandlactase from fermentedcocoa as a new source ofprobiotics. Cocoa pulp fermented for 36 hours at room temperature, and the yields are six bacterial colonies which isolated on the MRS broth and MRS agar. The six isolates will be selected to resistance of acid pH (pH2; 2.5 and 3), then the bacteria were used to antimicrobials test for Escherichia coli ATCC 25922 and Salmonella typi NBRC14237. The yields showed that the inhibition zone (antimicrobial activities) of four isolates bacteria are powerful. TSIA medium (Triple Sugar Iron Agar)was used for lactase screening, and obtained two bacteria that produce lactase, then the isolates were tested for protease screening, and the yield is one isolate (G6) has a largest clear zone (15 mm). The Lowry method was used to determine of protease concentration, and the yield showed that maximum concentration of protease is 0.88mg/mL at 18 hours incubation time for isolate G6. The genomic identification of 16SrRNA used the 9F and 1541R primers resulted that the G6 isolate have 86% similarity with Lactobacillus brevis strain FE.
Purifikasi Parsial Enzim Ekstraseluler (Anoxybacillus sp.) yang Diisolasi dari Sumber Air Panas Bukit Kili Solok serta Aplikasinya untuk Menghidrolisis Limbah Berserat Octarya, Zona; Syukur, Sumaryati; Purwati, Endang
Jurnal Natur Indonesia Vol 15, No 2 (2013)
Publisher : Lembaga Penelitian dan Pengabdian kepada Masyarakat Universitas Riau

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (233.856 KB) | DOI: 10.31258/jnat.15.2.106-114

Abstract

Termostable enzyme from thermophilic bacteria is very potential to improve technical enzyme in industry which used hightemperature. High water temperature exerts selection pressure on microbial species leading to specific flora that survivesand tolerates heat stress. The relative isolation and unique physical properties of Bukit Kili Ketek Hot Springs in Solok,West Sumatera may yield unique thermophiles. The generation of extracellular enzymatic bacterial is highly desirable forproduction of hydrolitic enzymes, which are useful in various industrial application and in animal feeds. This study,conducted to purify extracellular enzymes from thermophilic bacteria (Anoxybacillus sp.). This bacteria was isolated inBukit Kili Ketek Hot Springs, and after identified by analysis of 16S rRNA gene, 97% of similiarty with Anoxybacillus sp.was of obtained. The temperature of the hot waters was 52°C and the pH was 8. Extracellular and hydrolytic enzymeproduction were screened by qualitative SDS-PAGE method. SDS-PAGE analysis gave protein bands at ±110 kDa, ±80 kDa,±60 kDa, 50 kDa, 25 kDa, and ±10 kDa, respectively. Extracellular enzymes were used to degrade cellulose waste. Thecellulose activity for degradation of baggasse and pineapple pulp was 0,451 IU/mL and 0,310 IU/mL at 50°C and pH 6.