Garuda - Garba Rujukan Digital

p-Index From 2019 - 2024

1.116

P-Index

This Author published in this journals

All Journal ACTA VETERINARIA INDONESIANA Jurnal Sain Veteriner Buletin Peternakan Jurnal Veteriner Jurnal Ilmu Ternak dan Veteriner Indonesian Journal of Biotechnology Jurnal Ilmu Peternakan dan Veteriner Tropis (Journal of Tropical Animal and Veterinary Sciences) Jurnal Kedokteran Hewan

Tri Untari

Unknown Affiliation

Author-ID : 405319

Agriculture, Biological Sciences & Forestry Biochemistry, Genetics & Molecular Biology Economics, Econometrics & Finance Immunology & microbiology Materials Science & Nanotechnology Medicine & Pharmacology Veterinary Other

Published : 21 Documents Claim Missing Document

Claim Missing Document

Articles

1 2 3

Efektivitas Fluoroquinolon Terhadap Isolat Bakteri Saluran Pencernaan Ular Sanca Batik (Python reticulatus) Agustina Dwi Wijayanti; Antasiswa Windraningtyas Rosetyadewi; Tri Untari
Acta VETERINARIA Indonesiana Vol. 1 No. 1 (2013): Januari 2013
Publisher : IPB University

Telah dilakukan penelitian tentang efektivitas antibiotika golongan fluoroquinolon (flumequin dan enrofloksasin) terhadap Salmonella dan E. coli yang diisolasi dari saluran pencernaan ular sanca batik (Python reticulatus). Penelitian ini bertujuan untuk mengetahui efektivitas fluoroquinolon terhadap infeksi saluran pencernaan pada ular dan reptil pada umumnya. Penelitian dilakukan dengan menggunakan 8 ekor sanca batik dewasa yang menderita gangguan pencernaan dengan lesi klinis berupa mouthrot. Sampel ulas kloaka dan mulut serta sampel darah diambil dari semua ular, untuk selanjutnya dilakukan uji mikrobiologis berupa isolasi dan identifikasi bakteri melalui media Brilliant Green Agar (BGA), Mc Conkay Agar (MCA), Triple Sugar Iron (TSI) dan media biakan murni. Isolat murni yang didapatkan adalah Salmonella spp. dan E. coli dan selanjutnya dilakukan uji sensitivitas bakteri terhadap flumequin dan enrofloksasin serta penentuan Minimum Inhibitory Concentration (MIC) untuk enrofloksasin. Hasilnya adalah kedua antibiotika efektif terhadap Salmonella dan intermediet terhadap E. coli. Nilai MIC enrofloksasin terhadap Salmonella adalah 2,5 μg/ml.

The use of earthworm meal (Lumbricus rubellus) as anti-pullorum agent in feed additive of broiler chicken Ema Damayanti; Ahmad Sofyan; Hardi Julendra; Tri Untari
Jurnal Ilmu Ternak dan Veteriner Vol 14, No 2 (2009): JUNE 2009
Publisher : Indonesian Center for Animal Research and Development (ICARD)

The aim of this research was to study the use of earthworm meal (TCT) L. rubellus as anti pullorum agent in poultry feed additive (IP). The antibacterial activity of TCT against Salmonella pullorum was examined using diffusion agar method at each of the following concentrations: 0, 25, 50, 75 and 100% (w/v) in 100 µL DMSO. In vivo test was conducted using 80 broiler chicken and were infected by S. pullorum with treatments of: IP0: IP contained 0% TCT, IP1: IP contained 25% TCT, IP2: IP contained 50% TCT, IP3: IP contained 75% TCT and IP4: IP contained 100% TCT. Each treatment was replicated 4 times with 4 chicks each. Feed additive was periodically fed to broiler during 7 days before and 10 days after infection. Anti-pullorum activities were evaluated using serology test, isolation and biochemical identification of S. pullorum. The results showed that 75% TCT was optimum to inhibit S. pullorum in vitro. The isolation and identification of S. pullorum results showed that 0 out of 8 (0%) broilers treated with IP4 was not infected by S. pullorum whereas 1 out of 2 (50%) broilers treated with IP0 were infected by S. pullorum. The reduction of S. pullorum prevalence as followed by increasing TCT in feed additive. In conclusion, TCT as poultry feed additive could inhibit S. pullorum infection. Key words: Earthworm Meal, Feed Additive, S. Pullorum

Molecular Study on The Pathogenicity of Avian Influenza Virus Haryadi M. Wibowo; Heru Susetya; Tri Untari; Khrisdiana Putri; Charles Rangga Tabbu
Indonesian Journal of Biotechnology Vol 11, No 2 (2006)
Publisher : Universitas Gadjah Mada

Highly pathogenic avian influenza virus (HPAI) differ from Low pathogenic avian influenza virus (LPAI) basedon multiple basic amino acid motif of the carboxylterminus of HA1, especially arginine and lysine. The propose ofthis work was toamplify and sequence the cleavage site region of HA gene of avian influenza virusisolated from bothcases with characteristic or unspecific lesion, using reversetranscriptase polymerase chain reaction (RT-PCR). Primerdesaigned for amplification and sequence was H5-F: 5’ ggagactcagcaatcccatgaaaag 3’ and H5-R:5’ccataccaaccgtctaccattcc 3’, and expected product size was 246 bp. The result indicated that all avian influenzavirus (AIV)-isolates originated from chicken with both specific and non specific lesion show a multiple basic aminoacid motif -PQRERRRKKR//GLF- and classified as highly pathogenic avian influenza. Philogenetic study of HAgenefragment indicated that each type of characteristic lesion created philo-groups.Key words: avian influenza, lesion, hemagglutinin, cleavage site, phylogeny.

Evaluation of rapid detection kit against avian influenza A virus and H5 subtype for field Sample Michael Haryadi Wibowo; Tri Untari; Sidna Artanto; Krisdiana Putri; Surya Amanu; Widya Asmara
Indonesian Journal of Biotechnology Vol 21, No 1 (2016)
Publisher : Universitas Gadjah Mada

Avian influenza virus is poultry viral disease, which causes high economic losses. Various efforts have been made to control the disease. One effort is required screening fast and precise diagnostic test. This study was aimed to determine the potential of rapid test kit of AIV/H5 Anigen Rapid Test for the detection of AI virus types A and subtype H5 in the field. Some tests were carried out, e.g.: the potential test, cross-reaction test, sensitivity and specificity test. Potency test was done to evaluate potential of detection limits of the kit, by having the test of serial dilution of AI virus positive control. Cross-reaction test was done to detect antigens other than AI virus H5N1, e.g.: IB virus of Massachuset strain, IBV strain 4-91, Newcastle Disease virus, and Escherichia coli. Sensitivity and specificity test were applied to the filed samples which clinically and laboratory were confirmed as H5N1 positive. To confirm the result of rapid test was then being done by reverse transcriptase polymerase chain reaction. Based on these results it can be concluded that, Anigen Kit AIV/H5 Ag Rapid Test can detect antigen-containing samples having AI virus HA titer up to 26of type A virus, and up to 25 for subtype H5 virus. Anigen Kit AIV/H5 Ag Rapid Test showed no cross-reactions with Infectious Bronchitis virus, Newcastle Disease virus, and Escherichia coli. Anigen A Rapid Test Kit AIV Ag showed a sensitivity of 50% and specificity of 100%, while Anigen Ag Rapid Test Kit AIV/H5 showed a sensitivity of 25% and specificity is 100%.

Isolasi Dan Identifikasi Staphylococcus aureus Pada Susu Anjing Di Wilayah Yogyakarta Guntari Titik Mulyani; Andriani Dwi Hapsari; Soedarmanto Indarjulianto; Tri Untari; Yanuartono .; Slamet Raharjo; Hary Purnamaningsih
Jurnal Sain Veteriner Vol 26, No 1 (2008): JUNI
Publisher : Fakultas Kedokteran Hewan Universitas Gadjah Mada bekerjasama dengan PB PDHI

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.22146/jsv.414

KORELASI UJI HAMBATAN HEMAGLUTINASI DAN ENZYME LINKED IMMUNOSORBENT ASSAY UNTUK EVALUASI TITER ANTIBODI SETELAH VAKSINASI DENGAN VIRUS INFECTIOUS BRONCHITIS PADA AYAM Tri Untari
Jurnal Sain Veteriner Vol 22, No 1 (2004): Juli
Publisher : Fakultas Kedokteran Hewan Universitas Gadjah Mada bekerjasama dengan PB PDHI

Isolasi dan Identifikasi Bakteri dari Ayam Broiler yang menunjukkan Gejala Penyakit Respirasi Tri Untari
Jurnal Sain Veteriner Vol 21, No 1 (2003): JULI
Publisher : Fakultas Kedokteran Hewan Universitas Gadjah Mada bekerjasama dengan PB PDHI

Studi Lesi Makroskopis dan Mikroskopis Embrio Ayam yang Diinfeksi Virus Newcastle Disease Isolat Lapang yang Virulen Hamdu Hamjaya Putra; Haryadi Wibowo; Tri Untari; Kurniasih Kurniasih
Jurnal Sain Veteriner Vol 30, No 1 (2012): JUNI
Publisher : Fakultas Kedokteran Hewan Universitas Gadjah Mada bekerjasama dengan PB PDHI

Newcastle disease (ND) is caused by Avian paramyxovirus, family Paramyxoviridae, one of the major diseases in chickens. This research was aimed to find lesions in chicken's embryo organs macroscopically andmicroscopically, infected by pathogenic ND virus. Embryonic chicken eggs (ECE) were inoculated by the ND Salatiga virus and ND La Sota virus as a control avirulent virus. Aquabidestilata used as a negative control. ECEwich showed the death of the embryos, stored in the refrigerator. The allantois fluid was collected, for further examination of viral growth. Chicken embryos that died then observed macroscopically. The organs of chicken embryos were made into histopathologic preparations stained with Hematoxylin and Eosin (H&E) for microscopic analysis. The identification of ND virus growth on isolates was done by haemagglutination andhaemagglutination inhibition test using an anti-ND serum. The chicken embryos that were infected by the ND Salatiga virus died approximately 26 hours post-inoculation. Macroscopic lesions were visible as haemorrhagein the skin. Microscopic lesions indicated the congestion and haemorrhage in lungs, inflammation and congestion in the skin, congestion in intestines, liver, kidneys and heart. There was also mild congestion on theskin in chicken embryos infected by ND La Sota virus. The microscopic lesions showed congestion in lungs, liver, kidneys and heart, also the inflammation and congestion on the skin. The macroscopic and microscopic lesions of chicken embryos infected by the ND Salatiga virus were more severe than lesions caused by ND La Sota virus.Key words: Newcastle disease, chicken embryos, macroscopic lesions, microscopic lesions, La Sota

Pemodelan Epidemiologi Kejadian Multidrug Resistance Bakteri Escherichia coli pada Peternakan Ayam Komersial di Kabupaten Blitar Freshinta Jellia Wibisono; Bambang Sumiarto; Tri Untari; Mustofa Helmi Effendi; Dian Ayu Permatasari; Adiana Mutamsari Witaningrum
Jurnal Sain Veteriner Vol 39, No 3 (2021): Desember
Publisher : Fakultas Kedokteran Hewan Universitas Gadjah Mada bekerjasama dengan PB PDHI

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.22146/jsv.52071

Sifat resistensi bakteri Escherichia coli terhadap antibiotik mengakibatkan terbatasnya pilihan pengobatan. Perkembangan lebih lanjut dari resistensi bakteri dapat menyebabkan munculnya multidrug resistance pada bakteri, sehingga meningkatkan morbiditas dan mortalitas penyakit. Interaksi penyebaran kejadian multidrug resistance pada Escherichia coli yang terjadi pada populasi sangat kompleks, sehingga sulit memahami dinamika penyebaran berskala besar. Pendekatan pemodelan menjadi sangat penting untuk pengambilan keputusan tentang program pengendalian penyakit infeksi. Penelitian ini merupakan penelitian epidemiologi deskriptif analitik dengan desain cross-sectional study. Metode analisis menggunakan analisis regresi logistic untuk mendapatkan pemodelan kejadian multidrug resistance bakteri Escherichia coli pada tingkat ternak, dan menggunakan regresi linier untuk mendapatkan pemodelan kejadian multidrug resistance bakteri Escherichia coli pada tingkat peternakan. Hasil dari penelitian ini menunjukkan Distribusi kasus kejadian multidrug resistance pada ayam komersial di Kabupaten Blitar menunjukkan prevalensi kejadian pada tingkat peternakan sebesar 95.9%. Pemodelan kejadian multidrug resistance bakteri Escherichia coli tingkat ternak menghasilkan model regresi logistik ganda Ln () = 0.21964 + 1.60374 RefTS + 1.44989 Broiler + 0.96022 PakRacik + 0.84182 ProgAb – 1.16667 SaniKan – 1.15046 Tritendap, dengan peluang kejadian sebesar 94 %. Pemodelan kejadian Multidrug resistance bakteri Escherichia coli tingkat peternakan menghasilkan model regresi linier, MDR (Y) = 0.57886 + 0.16105 JUMitra + 0.19342 ProgAb – 0.16178 Dukudrh. Model ini memiliki wilk saphiro mendekati 1 (W = 0,9573) sehingga model persamaan ini merupakan model yang baik untuk kejadian Multidrug resistance bakteri Escherichia coli tingkat peternakan.

Hematology Profile and Liver Histopathology in Escherichia coli Infected Layers Treated with Combination of Phyllanthus ( Phyllanthus niruri L. ) and Turmeric ( Curcuma domestica ) Sri Hartati; Tri Untari; Bambang Sutrisno; Ida Fitriana
Jurnal Sain Veteriner Vol 39, No 1 (2021): April
Publisher : Fakultas Kedokteran Hewan Universitas Gadjah Mada bekerjasama dengan PB PDHI

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.22146/jsv.58423

Colibacillosis a disease that can cause considerable economic loss, remains an important health problem. Phyllanthus (Phyllanthus niruri L) and turmeric (Curcuma domestica) are herbs that can be used as immunomodulators. This study was aimed to determine the level of safety of the combination of phyllanthus and turmeric on hematology profile and liver histopathology of layers with colibacillosis. The layers were assigned to the following of 5 groups: a) colibacillosis group without treatment, b) colibacillosis group with 500 mg/kg BW of phyllanthus, c) colibacillosis group with 300 mg/kg BW of turmeric, d) colibacillosis group with phyllanthus and turmeric combination (1:1), e) colibacillosis group with combination of phyllanthus and turmeric (1:2) . After 21 days of treatment, blood and liver sample were collected. The hematological profile (hemoglobin, hematocrit, erythrocyte and leukocyte counts) and liver histology were examined. The result were analyzed statistically by one-way ANOVA. The group that received phyllanthus had higher levels of hemoglobine, haematocrit and erythrocytes than the control group. However, no significant differences were found for the overall groups. Treatment with the combination of turmeric and phyllanthus for 21 days did not cause changes in the hematological profiles or liver histology, and therefor this herbal combination can be used as an alternative therapy for colibacillosis in layers.

Co-Authors Adiana Mutamsari Witaningrum AETH. Wahyuni Agnesia Endang Tri Hastuti Wahyuni Agustina Dwi Wijayanti Agustina Dwi Wijayanti Ahmad Sofyan Anastasia Endang Tri Hastuti Wahyuni Andriani Dwi Hapsari Antasiswa W. Rosetyadewi Antasiswa Windraningtyas Rosetyadewi Arfian Rahma Shanti Asmarani Kusumawati Asmarani Kusumawati Atik Ratnawati Bambang Sumiarto Bambang Sumiarto Bambang Sumiarto Bambang Sutrisno Bambang Sutrisno Charles Rangga Tabbu Dian Ayu Permatasari Dian Ayu Permatasari Ema Damayanti Guntari Titik Mulyani Hamdu Hamjaya Putra Hardi Julendra Hary Purnamaningsih Haryadi M. Wibowo Haryadi Wibowo Heru Susetya Ida Arlita Wulandari Ida Fitriana Khrisdiana Putri Krisdiana Putri Kurniasih . Kurniasih Kurniasih Laksono Trisnantoro Liza Angeliya Maria Anggita Marla Anggita Michael Haryadi Wibowo Mustofa Helmi Effendi Nyoman Reishita Andriyani Okti Herawati Sidna Artanto Sidna Artanto Sidna Artanto Sitarina Widyarini Slamet Rahardjo Soedarmanto Indarjulianto Sri Hartati Sri Hartati Surya Amanu Surya Amanu Wibisono, Freshinta Jellia Widya Asmara Widya Asmara Yanuartono . Yuli Purwandari Kristiangingrum

Title

Found 21 Documents
Search

Abstract

Abstract

Abstract

Abstract

Abstract

Abstract

Abstract

Abstract

Abstract

Abstract

Title Search

Found 21 Documents Search

Abstract

Abstract

Abstract

Abstract

Abstract

Abstract

Abstract

Abstract

Abstract

Abstract

Title

Found 21 Documents
Search