cover
Article Per Year (5 Year)
All
Home Page
OAI Link
Editorial Team
Contact
Reviewer
Google Scholar
Contact Name
I G. Made Krisna Erawan
Contact Email
krisnaerawan@unud.ac.id
Phone
-
Journal Mail Official
-
Editorial Address
Animal Hospital, Faculty of Veterinary Medecine Building, Udayana University, 2nd Floor, Jalan Raya Sesetan, Gang Markisa No 6, Banjar Gaduh, Sesetan, Denpasar, Bali, Indonesia
Location
Kota denpasar,
Bali
INDONESIA
Jurnal Veteriner
Published by Universitas Udayana
ISSN : 14118327     EISSN : 24775665     DOI : https://doi.org/10.19087/jveteriner
Core Subject : Health,
Veterinary
Jurnal Veteriner memuat naskah ilmiah dalam bidang kedokteran hewan. Naskah dapat berupa: hasil penelitian, artikel ulas balik (review), dan laporan kasus. Naskah harus asli (belum pernah dipublikasikan) dan ditulis menggunakan bahasa Indonesia atau bahasa Inggris. Naskah ilmiah yang telah diseminarkan dalam pertemuan ilmiah nasional dan internasional, hendaknya disertai dengan catatan kaki
Arjuna Subject : -
Articles 1,053 Documents
 1   2   3   4   5 
Karakter Biologi Isolat Trypanosoma evansi Asal Wabah di Sumba dan Implikasinya Setelah Dipasase Berulang pada Mencit Dyah Haryuningtyas Sawitri; April Hari Wardhana
Jurnal Veteriner Vol 20 No 2 (2019)
Publisher : Faculty of Veterinary Medicine, Udayana University and Published in collaboration with the Indonesia Veterinarian Association

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (239.604 KB) | DOI: 10.19087/jveteriner.2019.20.2.148

Abstract

Trypanosoma evansi, the agent of Surra, is a widely distributed blood protozoan infecting various species of livestock, pets and wild animals. So far, the biological character differences of T. evansi isolate from outbreak areas after re-passaging have not been reported. The aims of this study was to investigate characteristics of T. evansi collected from an outbreak area in 2012 in Sumba Island after re-passaging in mice based on pathogenicity.The study was divided into two steps of biological assays. Step 1 was addressed to observe the pathogenicity level of isolate compared to both high and low virulence controls. A total of 27 mice was divided into 9 groups (3 mice /group) e.g. negative control (KN); Positive control of high virulence (KBang87); Positive control of low virulence (KPml287); PI (Smb370); PII (Smb371); PIII (Smb372); PIV (Smb373); PV (Smb374) and PVI (Smb375). Step 2 was to look at the concistentcy of parasitemia level of isolates selected from step 1. A total of 21 mice was divided into 6 groups reinfected by Smb 372 (P VII, PVIII, PIX); Smb 375 (PX, PXI, PXII) and negative control. The results demonstrated that the parasitemia pattern of mice groups infected by Smb372 (PIII) and Smb375 (P VI) was similar to KBang87 (high virulence) and KPml287 (low virulence) group, respectively (Step 1). The step 2 results revealed that repassaging of the Smb372 isolate (PIII) in three different groups of mice (PVII, PVIII, PIX) showed similar parasitemia pattern with the origin isolates. However, the Smb375 had various parasitemia patterns among PX, PXI and PXII groups. They were moderate virulence (mixed high and low virulences) indicating that Smb375 was a mixed infection of T. evansi varians. Animals infected with either low or moderate virulence isolates need serious attention because they might act as potential reservoirs to infect other animals.
Infeksi Microsporum canis pada Kucing Penderita Dermatitis (MICROSPORUM CANIS INFECTION IN DERMATITIS CATS) Soedarmanto Indarjulianto; Yanuartono Yanuartono; Sitarina Widyarini; Slamet Raharjo; Hary Purnamaningsih; Alfarisa Nururrozi; Nurman Haribowo; Hizriah Alief Jainudin
Jurnal Veteriner Vol 18 No 2 (2017)
Publisher : Faculty of Veterinary Medicine, Udayana University and Published in collaboration with the Indonesia Veterinarian Association

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (112.373 KB) | DOI: 10.19087/jveteriner.2017.18.2.207

Abstract

Dermatitis in cats can be caused by Microsporum canis and is zoonotic. This study aims to perform clinical examination, laboratory examination, isolation, and identification of mold M. canis in cats with dermatitis. Skin scrapped from 30 cats that clinically showed lesions of dermatitis i.e. combination of alopecia, erythema, papules, pustules, scaly, and crusty were used in this study. Examination of clinical lesions and screening tests using the Wood’s lamps were performed prior to sampling. Skin scrapes samples were cultured onto Sabouraud’s dextrose agar medium, incubated at 28 ° C and colonies were identified macroscopically then stained using Lactophenol Cotton Blue for microscopic examination. Seventen of the 30 samples (56.7%) were identified as M. canis macroscopically and microscopically. The skin lesions observed in the 17 M. canis infected cats were erythema, alopecia, scaly, and crusty distributed to the ear, body, neck, back and tail of cats, respectively ABSTRAK Dermatitis pada kucing dapat disebabkan oleh Microsporum canis dan bersifat zoonotik. Penelitian ini bertujuan melakukan pemeriksaan klinis, pemeriksaan laboratoris, isolasi, dan identifikasi kapang M. canis pada kucing penderita dermatitis. Kerokan kulit dari 30 ekor kucing yang secara klinis menunjukkan lesi dermatitis berupa kombinasi dari alopesia, eritema, papula, pustula, bersisik, dan berkerak digunakan dalam penelitian ini. Pemeriksaan lesi klinis dan uji screening dengan lampu Wood’s dilakukan sebelum pengambilan sampel. Sampel kerokan kulit dikultur pada media Sabouraud’s dextrose agar, diinkubasi pada suhu 28°C dan diidentifikasi secara makroskopis. Koloni yang tumbuh diperiksa secara mikroskopis menggunakan pewarnaan Lactophenol Cotton Blue. Hasil penelitian menunjukkan 17 dari 30 sampel (56,7%) teridentifikasi M. canis secara makroskopis dan mikroskopis. Lesi kulit yang ditemukan pada 17 kucing positif terinfeksi M. canis menunjukkan adanya eritema, alopesia, bersisik, dan berkerak dengan lokasi penyebaran pada telinga, badan, leher, punggung atau ekor.
STUDY ON SPERM AGGLUTINATION WITH CHARACTERIZATION OF PLASMACOLLECTED FROM EPIDIDYMIS AND EJACULATE IN RAM Muhammad Haviz; Arief Boediono; M Agus Setiadi; Srihadi Agungpriyono; Mokhamad Fahrudin
Jurnal Veteriner Vol 9 No 4 (2008)
Publisher : Faculty of Veterinary Medicine, Udayana University and Published in collaboration with the Indonesia Veterinarian Association

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (582.717 KB)

Abstract

This study was designed to optimalize the use of epididymal or ejaculate sperm and plasma for in vitro fertilization, that sperm agglutination was found at preparation. The rate of sperm agglutination was calculated the head-to-head sperm agglutination that were incubated in Krebs Ringer-(N-(2hydroxyethyl)piperazine-N’-(2-ethenesulfonic acid) or KR-HEPES medium in 38.50C with 5% CO2 at 1, 3, 5 and 7 hours culture in vitro. The rate of head-to-head sperm agglutination were decreased with time treatments. The cauda of sperm agglutination was lower than that caput, corpus epididymal and ejaculate sperm with statistically significant (P<0.01). These result reflected that distribution of anti-agglutinin might be higher in cauda epididymal than that other areas. Number of protein were characterize with SDS-PAGE as follow 11 bands in caput epididymal, 9 bands in corpus epididymal, 2 bands in cauda epididymal and 4 bands in seminal plasma. The higher distribution of protein was found at range 25-40 kDa in epididymal plasma of ram. However, further investigation should be conducted to determine presumptive anti-agglutinin by advance method.
Aplikasi Kandidat Pemindai untuk Diagnosis Gen Shiga like toxin-2 dari Escherichia coli O157:H7 (PROBE APLICATION TO DIAGNOSTIC PROGRAME OF SHIGA LIKE TOXIN-2 (STX2) GEN FROM ESCHERICHIA COLI O157:H7) I Wayan Suardana; I Nengah Sujaya; Wayan Tunas Artama
Jurnal Veteriner Vol 13 No 4 (2012)
Publisher : Faculty of Veterinary Medicine, Udayana University and Published in collaboration with the Indonesia Veterinarian Association

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (145.367 KB)

Abstract

A Shiga-like toxin producing Escherichia coli O157:H7 has been detected in cattle fecal sample, atbeef, and human as well as in beef and indicating that the agent is a harmful zoonosis bacteria. Geneticanalysis of Shiga toxin Escherichia coli (STEC) gene is important for development of probe to improve thediagnosis method for the agent. The study consisted of degrading and synthezing of PS2 probe withnucleotide sequence, 5’TTACACATATATCAGTGCCCGGTGTGA-CAACGGTTTCCATGACAACGGACAGCAGTTATACCACTCTGCAACGTGTCGCAGCGCTGGAA-CGTTCCGGAATGCAAATCAGTCGTCA‘3, analyzing of labeled probe, extracting of genomic DNA, hybridizing dot-blot DNA-DNA, and finallydetecting of hybridization signal. The results show that PS2 probe can be used to detect Shiga like toxingene (stx2 gene) from E. coli O157:H7. The Probe has labeling efficiency up to 10 pg/?l. PS2 probe with 25ng/ml concentration has a capability to detect it’s complemantary in 10 ng/?l DNA samples concentration.
Respons Peristalsis dan Neuron Mienterik Nitrergik Usus Halus Kelinci yang Diinfeksi Eimeria magna Amelia Hana; Soesanto Mangkoewidjojo; Siti Isrina Oktavia Salasia2,; Dwi Liliek Kusindarta3
Jurnal Veteriner Vol 12, No 2 (2011)
Publisher : Faculty of Veterinary Medicine, Udayana University and Published in collaboration with the Indonesia Veterinarian Association

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (193.154 KB)

Abstract

Penelitian ini bertujuan untuk mengetahui respon usus kelinci yang diinfeksi Eimeria magna denganmengamati frekuensi dan amplitudo kontraksi peristalsis, dan jumlah neuron mienterik nitrergik usushalus. Hewan percobaan yang digunakan adalah 60 ekor kelinci jantan lokal sehat umur 5 bulan dengankisaran berat badan 1,5-1,8 kg, dan bebas koksidiosis. Seluruh kelinci percobaan diadaptasikan dengankondisi lingkungan penelitian selama 7 hari dengan pakan pellet dan air minum ad libitum. Kelincidipelihara dalam kandang individual. Enam puluh ekor kelinci tersebut dibagi secara acak menjadi 3kelompok masing-masing 20 ekor. Kelompok I sebagai kontrol (K-0) diberi 1,0 ml akuades/ekor per oral,kelompok II (K-10) diinfeksi 10x106 ookista E. magna/ekor per oral dosis tunggal, dan kelompok III (K-20)diinfeksi 20x106 ookista E. magna /ekor per oral dosis tunggal. Pascainfeksi setiap hari 4 ekor per kelompokdianestesi dengan uretan (1,55 g/kg BB dalam larutan 25%, secara intraperitoneal), kemudian dibedah,diambil segmen usus halus (duodenum, jejunum, dan ileum). Segera setelah itu kelinci dibunuh dengancara dislokasi cervikal. Segmen usus halus diukur gerak peristalsis secara elektromiografik. Selanjutnyasampel tersebut dibuat preparat histokimia dengan teknik pewarnaan Nicotinamide Adenine DincleotidePhosphate-diaphorase (NADPH-d) untuk mengetahui jumlah neuron mienterik nitrergiknya. Data frekuensidan amplitudo kontraksi peristalsis, dan jumlah neuron mienterik nitrergik usus halus kelinci dianalisissecara statistika dengan sidik ragam dan uji-t (LSD). Hasil penelitian menunjukkan bahwa infeksi10x106 dan 20x106 ookista E. magna dapat menyebabkan timbulnya peningkatan frekuensi peristalsisusus halus (p<0,01), penurunan amplitudo kontraksi usus halus (P<0,01), dan penurunan jumlah neuronmienterik nitrergik usus halus (P<0,01) dibandingkan kelompok kontrol (K-0). Dari hasil disimpulkanbahwa infeksi ookista E. magna dapat menyebabkan peningkatan frekuensi peristalsis, penurunanamplitudo kontraksi, dan penurunan jumlah neuron mienterik nitrergik usus halus kelinci.
Perbandingan Kualitas Fisiokimia Kefir Susu Kambing dengan Kefir Susu Sapi (COMPARISON OF PHYSIOCHEMICAL QUALITY OF GOAT MILK KEFIR WITH COW MILK KEFIR) Sulmiyati Sulmiyati; Nur Saidah Said; Deka Uli Fahrodi; Ratmawati Malaka; Fatma Fatma
Jurnal Veteriner Vol 19 No 2 (2018)
Publisher : Faculty of Veterinary Medicine, Udayana University and Published in collaboration with the Indonesia Veterinarian Association

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (88.023 KB) | DOI: 10.19087/jveteriner.2018.19.2.263

Abstract

Kefir is one of the fermented beverages which has a distinctive taste from other fermented milk products. Based on the results of several studies concluded that one that affects the quality of kefir is the milk of being used for. The purpose of this study was to examine the comparison of physiochemical quality of kefir made from goat’s milk and cow’s milk. This study used Completely Randomized Design (CRD) with two treatments and five replications using different milk which was goat’s milk and cow’s milk. Parameters measured were the weight gain of kefir grain (PBBK), ethanol content, the percentage of lactic acid and pH of kefir. The data obtained were analyzed by using the Analysis of Variance and if the treatment was significantly different, then the test continued with the Least Significant Difference (LSD). The results showed that kefir produced with different types of milk showed a significant effect (P <0.05) on pH parameters, lactic acid percentage, and ethanol content, but no significant effect (P>0.05) on the value of PBBK. It can be concluded that the best kefir made of goat milk has characteristics: pH value 3.89, the percentage of lactic acid 0.14; PBBK 26.61%; and 0.72% ethanol content.
The Prevalence of Alimentary Tract Worms in Domestic Cats and Stray Cats at Campus Area of Semarang State University, Central Java Rafita Farantika; R. Susanti
Jurnal Veteriner Vol 20 No 3 (2019)
Publisher : Faculty of Veterinary Medicine, Udayana University and Published in collaboration with the Indonesia Veterinarian Association

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (150.671 KB) | DOI: 10.19087/jveteriner.2019.20.3.316

Abstract

The aims of this study were to identify and measure the prevalence of alimentary tract worm in stray and domestic cats in the campus area of Semarang State University (Universitas Negeri Semarang/Unnes). As many as 30 cat feces samples: 10 stray cats samples (SC), 10 limited range domestic pet cats (LDC), and 10 indoor domestic pet cats (IDC) were used in this study. Examination of the feces samples was done by using the flotation method to identify the eggs of worms. Based on feces examination, eggs of four worms species i.e. Ancylostoma caninum, Clonorchis sinensis, Dipylidium caninum and Toxocara cati were found. Based the prevalence of worm eggs: A. caninum was found infected 4 out of 30 samples (13.3%), C. sinensis was found infected 2 out of 30 samples (6.6%), D. caninum was found infected 2 out of 30 samples (6.6%), and T. cati was found infected 10 out of 30 samples (33.3%).
SEBARAN ANTIAGLUTININ SPERMATOZOA DALAM PLASMA YANG DIKOLEKSI DARI EPIDIDIMIS DAN EJAKULAT DOMBA THE DISTRIBUTION OF SPERM ANTIAGGLUTINI IN PLASMA COLLECTED FROM EPIDIDYMIS AND EJACULATE OF RAM Muhamad Haviz; Srihadi Agungpriyono; Arief Boediono; Mokhamad Fahrudin; M Agus Setiadi
Jurnal Veteriner Vol 8 No 1 (2007)
Publisher : Faculty of Veterinary Medicine, Udayana University and Published in collaboration with the Indonesia Veterinarian Association

Show Abstract | Download Original | Original Source | Check in Google Scholar

Abstract

Penelitian untuk mengetahui tingkat aglutinasi antarkepala spermatozoa dan sebaran antiaglutinin dalam plasma asal epididimi dan ejakulat telah dilakukan untuk mengoptimalkan pemanfaatannya dalam fertilisasi in vitro. Tingkat aglutinasi dan aktivitas antiaglutinin plasma epididimis dan ejakulat domba dihitung dengan cara menghitung jumlah aglutinasi antarkepala spermatozoa setelah diinkubasikan selama 1, 3, 5, dan 7 jam in vitro dalam media Krebs Ringer- HEPES.
Anestesi Infus Gravimetrik Ketamin dan Propofol pada Anjing (THE GRAVIMETRIC INFUSION ANAESTHESIA WITH KETAMINE AND PROPOFOL IN DOGS) I Gusti Ngurah Sudisma; Setyo Widodo; Dondin Sajuthi; Harry Soehartono
Jurnal Veteriner Vol 13 No 2 (2012)
Publisher : Faculty of Veterinary Medicine, Udayana University and Published in collaboration with the Indonesia Veterinarian Association

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (269.965 KB)

Abstract

This study aim was to evaluate quality of anaesthesia by using gravimetric infusion anaesthesia withketamine and propofol in dogs. The quality of anaesthesia, duration of actions, and the physiological responsseof anaesthesia were evaluated in twenty domestic dogs. Anaesthesia was induced intramuscularly withatropine (0.03 mg/kg)-xylazine (2 mg/kg) (AX), intravenously ketamine-propofol (KP) (4 mg/kg), andmaintained with continuous intravenous infusion with pre-mixed propofol (P) and normal saline containing2 mg/ml of propofol and 2 mg/ml of ketamine (K). Domestic stray dogs were randomly divided into fivegroups. Groups AXKP-K2P2, AXKP-K4P4, and AXKP-K6P6 were treated with ketamine-propofol the dose0.2 mg/kg/minute, 0.4 and 0.6 mg/kg/minute respectively, while group AXKP-P4 was given propofol 0.4 mg/kg/minute and group AXKP-I was given isoflurane 1-2%. Heart rate (HR), respiratory rate (RR),electrocardiogram (ECG), blood oxygen saturation (SpO2), end tidal CO2 (ET CO2), and capillary refill time(CRT) were measured. No significant difference (P>0.05) found between the groups in anaesthetion times.All groups showed rapid and smooth inductions, prolonged surgical stage, and rapid recovery. Groups AXKPK2P2and AXKP-K4P4 showed minimal physiological effect on the dogs. The HR, RR, ET CO2, SpO2, CRT,and ECG wave were stabl. Combination of AXKP-K6P6 induced SpO2 depression, increased and instabilityof HR, RR and ET CO2. Groups AXKP-P4 showed decreased of HR and respiratory depression. All anaestheticcombinations showed no significant influence (P>0.05) on the electricity of the dog’s heart. The combinationof ketamine-propofol at dose 0.2 and 0.4 mg/kg/minute were found to be better as an application formaintaining anaesthesia by gravimetric continuous intravenous infusion. The method is a suitablealternative for inhalation anaesthesia in dogs.
Aktivitas Sediaan Gel Ekstrak Batang Pohon Pisang Ambon dalam Proses Penyembuhan Luka pada Mencit Bayu Febram Prasetyo; Ietje Wientarsih; Bambang Pontjo Priosoeryanto
Jurnal Veteriner Vol 11 No 2 (2010)
Publisher : Faculty of Veterinary Medicine, Udayana University and Published in collaboration with the Indonesia Veterinarian Association

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (184.19 KB)

Abstract

The purpose of this study is to examine the activity of Ambon banana extract in gel formulation on thewound healing process of mice skin (Mus musculus albinus) based on gross and microscopic observations.The wound healing process were observe grossly everyday while the microscopic lesion was observed on the3rd, 5th, 7th, 14th and 21st days after skin incisition. The wounded skin were sampled after the mice wereeuthanized for further microscopic observation. The gross parameters were the existence of blood coagulation,scab formation, wound covering and wound size. The microscopic parameters observed the percentation ofwound reepitelization and the the tickness of wound connective tissues (fibroblast). Gross lesion and thefibroblast thickness were presented descriptively as a qualitative data. Grossly, it was observed that thescab formation was faster in mice treated with the extract of ambon banana than that of negative control.Based on the research the ambon banana extrack in gel can be used in the acceleratiof wound healing.

Page 3 of 106 | Total Record : 1053

 1   2   3   4   5 

Filter by Year

2000 2023


Reset
Filter By Issues
All Issue Vol 24 No 1 (2023) Vol 23 No 4 (2022) Vol 23 No 3 (2022) Vol 23 No 2 (2022) Vol 23 No 1 (2022) Vol 22 No 4 (2021) Vol 22 No 3 (2021) Vol 22 No 2 (2021) Vol 22 No 1 (2021) Vol 21 No 4 (2020) Vol 21 No 3 (2020) Vol 21 No 2 (2020) Vol 21 No 1 (2020) Vol 20 No 4 (2019) Vol 20 No 3 (2019) Vol 20 No 2 (2019) Vol 20 No 1 (2019) Vol 19 No 4 (2018) Vol 19 No 3 (2018) Vol 19 No 2 (2018) Vol 19 No 1 (2018) Vol 18 No 4 (2017) Vol 18 No 3 (2017) Vol 18 No 2 (2017) Vol 18 No 1 (2017) Vol 17 No 4 (2016) Vol 17 No 3 (2016) Vol 17 No 2 (2016) Vol 17 No 1 (2016) Vol 16 No 4 (2015) Vol 16 No 3 (2015) Vol 16 No 2 (2015) Vol 16 No 1 (2015) Vol 15 No 4 (2014) Vol 15 No 3 (2014) Vol 15 No 2 (2014) Vol 15 No 1 (2014) Vol 14 No 4 (2013) Vol 14 No 3 (2013) Vol 14 No 2 (2013) Vol 14 No 1 (2013) Vol 13 No 4 (2012) Vol 13 No 3 (2012) Vol 13 No 2 (2012) Vol 13 No 1 (2012) Vol 12 No 4 (2011) Vol 12, No 3 (2011) Vol 12, No 2 (2011) Vol 12 No 1 (2011) Vol 11 No 4 (2010) Vol 11 No 3 (2010) Vol 11 No 2 (2010) Vol 11 No 1 (2010) Vol 10 No 4 (2009) Vol 10 No 3 (2009) Vol 10 No 2 (2009) Vol 10 No 1 (2009) Vol 9 No 4 (2008) Vol 9 No 3 (2008) Vol 9 No 2 (2008) Vol 9 No 1 (2008) Vol 8 No 4 (2007) Vol 8 No 2 (2007) Vol 8 No 1 (2007) Vol 7 No 4 (2006) Vol 4 No 2 (2003) Vol 4 No 1 (2003) Vol 2 No 4 (2001) Vol 2 No 3 (2001) Vol 2 No 2 (2001) Vol 2 No 1 (2001) Vol 1 No 1 (2000) More Issue