Article Per Year (5 Year)
p-Index From 2019 - 2024
5.783
P-Index
This Author published in this journals
All Journal Bioscience Jurnal Natur Indonesia BIOTIK: Jurnal Ilmiah Biologi Teknologi dan Kependidikan Biodidaktika : Jurnal Biologi dan Pembelajarannya BIOLINK (Jurnal Biologi Lingkungan, Industri, Kesehatan) JURNAL PENDIDIKAN ROKANIA BIOEDUSCIENCE Jurnal Biologi Tropis EKSAKTA : Jurnal Penelitian dan Pembelajaran MIPA Majalah Ilmiah Biologi BIOSFERA: A Scientific Journal Biodik : Jurnal Ilmiah Pendidikan Biologi Martabe : Jurnal Pengabdian Kepada Masyarakat PeTeKa Mimbar Ilmu Jurnal Ilmu Kedokteran dan Kesehatan Scripta Biologica Atrium Pendidikan Biologi Pelita Eksakta Journal On Teacher Education (Jote) Budapest International Research in Exact Sciences (BirEx Journal) Journal for Lesson and Learning Studies TROPICAL GENETICS Tropical Genetics Jurnal Serambi Biologi
Atifah, Yusni
Universitas Negari Padang
Agriculture, Biological Sciences & Forestry Arts Humanities Biochemistry, Genetics & Molecular Biology Chemical Engineering, Chemistry & Bioengineering Chemistry Civil Engineering, Building, Construction & Architecture Computer Science & IT Decision Sciences, Operations Research & Management Education Environmental Science Health Professions Immunology & microbiology Languange, Linguistic, Communication & Media Mathematics Medicine & Pharmacology Physics Public Health Social Sciences Transportation Other

Published : 55 Documents Claim Missing Document
Claim Missing Document
Check
Articles

Found 12 Documents
Search
Journal : Jurnal Serambi Biologi

 1   2 
THE EFFECT OF SALLACA VINEGAR ON HEMOGLOBIN LEVELS OF MICE (Mus musculus) FEEDED HIGH CHOLESTEROL Gilang Amanda; Yusni Atifah
Jurnal Serambi Biologi Vol. 7 No. 4 (2022): Jurnal Serambi Biologi
Publisher : Department of Biology, Faculty of Mathematics and Natural Sciences, Universitas Negeri Padang

Show Abstract | Download Original | Original Source | Check in Google Scholar

Abstract

Hemoglobin functions to carry oxygen and circulate throughout body. Several factors affect levels hemoglobin, one of which is food, foods high in cholesterol cause disruption of the quality hemoglobin, this can be overcome by giving Salacca vinegar on a reagular basis to mice that have cholesterol. This study aims to determine the effect of giving Salacca vinegar on Hb levels given high-cholesterol diet. The design used was completely randomized design with 5 treatments (K-: without high-cholesterol diet and SV (Salacca vinegar), K+: given high-cholesterol diet without being given SV, P1: SV 0.8ml, P2: SV 0.4ml and P3 : SV 0.2 ml) with 5 replications. Parameters observed were the Hb levels of male mice before and after being given Salacca vinegar. Data were analyzed using ANOVA, followed by further test of BNT with level of 5%. Results this study indicate that administration Salacca vinegar for 14 days can affect increase in the Hb levels of male mice. The treatment that showed a significant effect was the P3 treatment (SV 0.2ml) because it could increase Hb levels to 17.90 g/dL. Increase Hb levels was due to effect of flavonoids in Salacca vinegar, flavonoids keep haeme ion stable and facilitate production of methemoglobin.
Pengaruh Cuka Salak (Salacca Vinegar)Terhadap Kadar Asam Urat Mencit (Mus musculus L.) Jantan Yang Diberi Diet Tinggi Asam Urat Hafizh Alza Afra; Yusni Atifah
Jurnal Serambi Biologi Vol. 7 No. 1 (2022): Jurnal Serambi Biologi
Publisher : Department of Biology, Faculty of Mathematics and Natural Sciences, Universitas Negeri Padang

Show Abstract | Download Original | Original Source | Check in Google Scholar

Abstract

The habit of eating fast food can cause various diseases in the body due to the presence of preservatives in these foods. By consuming foods that contain lots of purines and alcohol will increase the content of uric acid (gout) in the blood as the main cause of gout. Uric acid (gout) is produced by the body so that its normal presence in the blood, then (gout) or uric acid is formed as a waste of protein metabolism in foods containing purines. The purpose of this study was to determine the effect of salacca vinegar on uric acid levels in male mice (Mus musculus L.). This research is an experimental research. The research was conducted from August to October 2021 at the Zoology Laboratory, Department of Biology, FMIPA, Padang State University. The method or design used was Completely Randomized Design (CRD) with 5 treatments and 5 replications for each group. The data obtained were analyzed for variance or analysis of variance (ANOVA). The results of this study showed that a dose of 0.8 ml of salacca vinegar in treatment 1 (P1) gave the best results in reducing uric acid levels in male mice (Mus musculus L.). Based on the research that has been done, it can be concluded that the treatment of giving salak vinegar has an effect on reducing uric acid levels in male mice (Mus musculus L.).
The Analysis of The Level Of Water Pollution in Lake Tambau Nagari Kampung Batu Dalam Danau Kembar District Solok Regency Through a Histopathological Study of Fish Kidneys Keiko Kasy Billah Keiko Kasy Billah; Abdul Razak; Yuni Ahda; Yusni Atifah
Jurnal Serambi Biologi Vol. 8 No. 2 (2023): Jurnal Serambi Biologi
Publisher : Department of Biology, Faculty of Mathematics and Natural Sciences, Universitas Negeri Padang

Show Abstract | Download Original | Original Source | Check in Google Scholar

Abstract

Water pollution is an indicator of deviations that occur in the properties of water from normal conditions. Lake Tambau, which is located in Jorong Air Tawa Utara, Nagari Kampung Batu Dalam, Danau Kembar District, Solok Regency, is one of the sources of fisheries used by the community to cultivate fish. The decline in water quality in Lake Tambau can be seen through physical observations such as the lack of water clarity, which indicates pollution in the lake water. Changes in environmental conditions that occur in Lake Tambau will be closely related to changes in the structure of kidney function in fish. Therefore research on kidney histopathology in fish is important to do in order to analyze changes in the histological structure of fish kidneys and analyze the level of water pollution that occurs in Lake Tambau. From the results of histopathological analysis of fish kidneys that have been obtained in Lake Tambau, it was found that there was hypertrophy, congestion, and necrosis. The results of a simple water analysis show that Lake Tambau water has a cloudy color, the temperature is above the normal threshold, has a pH of 9, there is sediment, and the color changes to dark when mixed with tea water which can be concluded that Lake Tambau water is heavily polluted. Key words water pollution,histopatology of fish kidneys
EFFECT OF WATER POLLUTION ON HISTOPATOLOGY FISH GILL: LITERATURE REVIEW Riri Putri Arianti; Yusni Atifah; Vauzia
Jurnal Serambi Biologi Vol. 8 No. 2 (2023): Jurnal Serambi Biologi
Publisher : Department of Biology, Faculty of Mathematics and Natural Sciences, Universitas Negeri Padang

Show Abstract | Download Original | Original Source | Check in Google Scholar

Abstract

Water pollution is a deviation of the properties of water from normal conditions. Water that is polluted by pesticide residues when it has reached a certain concentration will greatly affect the environment and the aquatic organisms that live in it. Fish is one of the aquatic biota that can be used as an indicator of the level of pollution that occurs in the waters. Fish that have been contaminated with contaminants such as hazardous materials for a long time will experience changes in structure or function and will also experience changes in histological conditions. Therefore, any changes that occur in the aquatic environment will directly or indirectly affect the gills both structurally and functionally. This type of research is research that uses the literature review method. The stages of literature collection used in this study refer to the Preferred Reporting Items for Systematic Review and Meta-Analysis (PRISMA) guidelines. This stage consists of four procedures, namely, identification, screening, eligibility and acceptance. This study shows that water pollution greatly affects the histopathology of fish gills because it can cause several disorders and diseases of fish gills. Key words : Water Pollution, Fish, histopathology of fish gills
Acetic Acid Content in Salak Sidempuan Vinegar Dilla Wirmaningsih; Yusni Atifah; Helendra
Jurnal Serambi Biologi Vol. 8 No. 3 (2023): Jurnal Serambi Biologi
Publisher : Department of Biology, Faculty of Mathematics and Natural Sciences, Universitas Negeri Padang

Show Abstract | Download Original | Original Source | Check in Google Scholar

Abstract

Acetic acid is the result of natural fermentation derived from processed fruits and vegetables. Sidempuan salak fruit (Salacca sumatrana) is a salak that has a very large water content and can be processed into processed vinegar, one of which is Sidempuan salak vinegar. This study was conducted through anaerobic fermentation using Saccharomhyces cerevisiae for seven days, then re-fermented aerobically using Acetobacter xylinum for nine days aimed at converting alcohol and producing acetic acid. To determine the level of acetic acid, it uses a quantitative test with an alkalimetric titration method using a 0.1 N NaOH solution and a 1% phenolphthalein indicator of three drops, then replicating three times to cause a pink color. Thus, the results were obtained from measuring acetic acid levels produced from the fermentation of Sidempuan salak vinegar of 4.8% and having a pH of 4. This result proves that acetic acid produced from the fermentation of Sidempuan salak vinegar has met the criteria for vinegar content that can be marketed and is suitable for public consumption.
Quality of Duck Eggs (Anas domesticus Lin.) After 15 Days of Preservation Using Jackfruit Leaf Extract (Arthocarpus heterophyllus Lamk. Azizah Mutmainah; Yusni Atifah
Jurnal Serambi Biologi Vol. 8 No. 3 (2023): Jurnal Serambi Biologi
Publisher : Department of Biology, Faculty of Mathematics and Natural Sciences, Universitas Negeri Padang

Show Abstract | Download Original | Original Source | Check in Google Scholar

Abstract

Eggs are an important source of animal protein for humans apart from meat and fish. Duck eggs (Anas domesticus Lin.) are one type of egg that is widely consumed by Indonesians besides chicken eggs. As a livestock product, eggs have the disadvantage of being easily damaged, prone to egg crack and microorganisms easily contaminate resulting in a decrease in egg quality. To maintain the quality of eggs, preservation is carried out on eggs by utilizing natural ingredients, one of which is using jackfruit leaves. The purpose of this study was to determine the effect of jackfruit leaf extract and the length of egg soaking on the length of storage of duck eggs. This type of research is an experimental study using a completely randomized design (CRD) with 9 treatments and 3 repetitions. Data were analyzed using analysis of variance and continued with the DMRT test if there were significant differences. The results showed that soaking eggs with 45% jackfruit leaf extract for 36 hours effectively inhibited egg weight loss. Soaking eggs with 15% jackfruit leaf extract for 24 hours is effective for maintaining the yolk index and haught unit value, while inhibiting the increase in egg pH is effective at 15% soaking for 36 hours.
Effect of Different Feeding on Uric Acid Levels in Mice (Mus musculus L.) Okta Diana; Yusni atifah; Helendra
Jurnal Serambi Biologi Vol. 8 No. 2 (2023): Jurnal Serambi Biologi
Publisher : Department of Biology, Faculty of Mathematics and Natural Sciences, Universitas Negeri Padang

Show Abstract | Download Original | Original Source | Check in Google Scholar

Abstract

Aim Uric acid is an acid that is formed from purine metabolism in the body. If uric acid levels in the blood exceed normal limits it is called hyperuricemia. Diet plays an important role in increasing or decreasing uric acid levels. Consuming foods high in purines can also increase uric acid levels. The purpose of this study was to determine the effect of different feeds on uric acid levels in mice. Methods This research is an experimental research. The research method used was a completely randomized design (CRD) with 3 treatments and 7 replications for each group. Results There is a difference in the average uric acid levels of mice in the K, P1, and P2 treatment groups. In the K treatment group, the average uric acid level of mice was 3,2 mg/dl. In the P1 treatment group, the average uric acid level of mice was 7,3 mg/dl. In the P2 treatment group, the average uric acid level of mice was 4,2 mg/dl. Main conclusions Differences in mice uric acid levels are influenced by diet, and consumption of foods high in purines. The highest average uric acid levels in mice were in the P1 treatment group of 7,3 mg/dl.
Specific Primer Design and Optimization of Monodehydroascorbate reductase (MDHAR) Gene Amplification in Rice (Oryza sativa L.) Jumatul Hafsah; Afifatul Achyar; Zulyusri; Yusni Atifah; Linda Advinda; Violita
Jurnal Serambi Biologi Vol. 8 No. 3 (2023): Jurnal Serambi Biologi
Publisher : Department of Biology, Faculty of Mathematics and Natural Sciences, Universitas Negeri Padang

Show Abstract | Download Original | Original Source | Check in Google Scholar

Abstract

Monodehydroascorbate reductase (MDHAR) is an enzyme responsible for growth and response to biotic and abiotic stress. MDHAR in rice shows a higher sensitivity to stress compared to other plants. This study aims to obtain specific primers for the MDHAR gene in rice to be used in PCR amplification so that it can amplify the MDHAR gene. Primers are designed using the Pickprimer and Geneious Primer tools. Optimization of annealing temperature was carried out using the gradient PCR method and then an in vitro primary specification test was carried out using the Touchdown PCR method. The results of the primary design obtained one candidate primer that met the ideal primer requirements, namely a pair of primers (5'-AAAAACACTGCATGGGTCGTC-3' and 5'-CGCCTACCGTTTCCCAAGTT-3') with an amplicon length of 160 bp. The visualization results of PCR products using 1.5% agarose showed that 6 samples were able to amplify the MDHAR gene at 160 bp in size. However, in each lane there is a non-specific DNA band (Primer dimer). In vitro primer specification testing with Touchdown succeeded in increasing product formation specifications and was able to reduce non-specific DNA bands (Primer dimers).
Primary Design and Optimization of Dehydroascorbate reductase (DHAR) Gene Amplification in Oryza sativa L. Isna Aryunita Putri Putri; Afifatul Achyar; Zulzusri Zulzusri; Yusni Atifah; Dwi Hilda Putri; Violita Violita
Jurnal Serambi Biologi Vol. 8 No. 4 (2023): Jurnal Serambi Biologi
Publisher : Department of Biology, Faculty of Mathematics and Natural Sciences, Universitas Negeri Padang

Show Abstract | Download Original | Original Source | Check in Google Scholar

Abstract

Dehydroascorbate reductase (DHAR) is one of the antioxidant enzymes involved in ascorbate recycling which catalyzes the reduction of oxidized ascorbate. DHAR is responsible for regenerating AsA from its oxidized state and regulating the redox state of cellular AsA which ultimately influences cell response and tolerance to ROS. DHAR is important for plant growth because it plays a role in the recycling of AsA. Rice is a plant that is sensitive to drought stress, one of the defense mechanisms of plants in dealing with drought stress is to activate the DHAR gene. The method that can be used to amplify the Dehydroascorbate reductase (DHAR) gene is by qRT-PCR. This method requires specific primers for the target gene. However, for now, the primary design of the DHAR gene is unknown. This study aims to design suitable primers for the amplification of DHAR target genes using the qRT-PCR technique, and to determine the optimal annealing temperature. Primer design was carried out using the PrimerQuest program, then viewed and then analyzed using GeneiousPrime, after which it was checked for specificity with primerBLAST. The primary design results with the best criteria were Forward DHAR 5'-GTACCCAACCCCGTCTCTTG -3' and Reverse DHAR 5'- TGGTAGAGCTTTGGTGCCAG -3' primers with a product size of 228 bp with an optimal temperature for PCR of 60ºC.
Inventory of Anura in Sarasah Salisikan Waterfall Area, Batang Anai, Padang Pariaman Regency, West Sumatra Yogi Saputra; Fitra Nugraha; Rijal Satria; Yusni Atifah
Jurnal Serambi Biologi Vol. 8 No. 4 (2023): Jurnal Serambi Biologi
Publisher : Department of Biology, Faculty of Mathematics and Natural Sciences, Universitas Negeri Padang

Show Abstract | Download Original | Original Source | Check in Google Scholar

Abstract

The purpose of this study was to collect data on amphibians of the Anura order in the Sarasah Salisikan waterfall area, Batang Anai District, Padang Pariaman Regency, West Sumatra. Because this area will be developed into a tourist area by the local nagari government and also plantation activities around the waterfall which will affect the number of species that inhabit this area. This study used the VES (Visual Encounter Survey) method, which is based on direct encounters with specimens in the field. The research was conducted in November-December 2022, the research results found a total of 9 species consisting of 5 families. This research area will be a place to conduct similar research in the future. Keywords :Inventory, Anura, Sarasah Salisikan Water fall, Batang Anai, West Sumatera
Co-Authors Abdul Razak Abdul Razak Abubakar Abubakar Adinda Rizky Maulina Afifatul Achyar Afifatul Achyar Afifatul Achyar Amsar Maulana Annisa Khaira Ardelia Febriana Ardi Ardi Azizah Mutmainah Cantika Riski Febiola Dadang Mulyadi Saleh Della Trya Monica Des M Dilla Wirmaningsih Divia Yuda Meisya Dwi Hilda Putri Dwi Hilda Putri Elsa Badriyya Elsa Yuniarti Elwidani Siregar Fadika Hayyuni Fathimah Azzahra Feby Djumaita Sari Ferix Riskierdi Fitra Arya Dwi Nugraha Fitra Nugraha Fitri Agustina Lubis Fitri Arsih Foarota Harefa Fuadiyah, Sa’diyatul Fuji Zahara Zahara Gilang Amanda Gilang Amanda Hafizh Alza Afra Hafizh Alza Afra Harahap, Fatma Suryani Heffi Alberida Helendra Helendra . Helendra Helendra Helka Yuliati Helsa Rahmatika Hendro Pramono Irma Leilani Eka Putri Iskandar Safri Hasibuan Iskandar Safri Hasibuan Isna Aryunita Putri Putri Jalilah Azizah Jumatul Hafsah Keiko Kasy Billah Keiko Kasy Billah Khairunisa Khairunisa LAILA TUSSIFAH LUBIS Linda Advinda Lufri Lufri Marten, Threo Wanda Mayang Anazalia Meilani Syaiful Melvariani Syari Batubara, Melvariani Syari Miftahul Jannah Mita Ariani Mutiara Ghina Mutiara Lubis Nabila Latu Fany Nella Fauziah Nurmaini Ginting Nurul Hiza Putri Nurul Ilma Septiani Okta Diana Pasaribu, Surya Elita Putri, Nurul Hiza Rahmadhani Fitri Rahmawati Darussyamsu Rahmi Suci Nadira Relsas Yogica Relsas Yogica Resti Fevria Reza Sapitri Rijal Satria Riri Putri Arianti Ristiono Ristiono Ristiono Ristiono S. Syamsurizal Sa'diatul Fuadiyah Sa’diyatul Fuadiyah Sahlan Tuah, Sahlan Samsiah Samsiah Sa’diatul Fuadiyah Silvira Ilhami Suci Fajrina Surya Elita Pasaribu Syamsurizal, S. Titisna Gumarni Vauzia, Vauzia Violita Violita Violita Violita Violita Violita Violita Widya Gusti Rahmawati D. Wulandari Wulandari Yogi Saputra Yulia Sistina Yuni Ahda Yuni Ahda Zulfahmi Zulfahmi Zulhandri Zulhandri Zulyusri Zulyusri Zulyusri, Zulyusri Zulzusri Zulzusri