Garuda - Garba Rujukan Digital

p-Index From 2019 - 2024

3.212

P-Index

This Author published in this journals

All Journal Jurnal Sain Veteriner Jurnal Akuakultur Rawa Indonesia ILMU KELAUTAN: Indonesian Journal of Marine Sciences Saintek Perikanan : Indonesian Journal of Fisheries Science and Technology Jurnal Sains dan Seni ITS Jurnal Ilmiah Perikanan dan Kelautan Jurnal Kelautan Tropis Journal of Aquaculture and Fish Health Grouper: Jurnal Ilmiah Perikanan Journal of Marine and Coastal Science Buletin Pengabdian

Gunanti Mahasri

Departemen Akuakultur, Fakultas Perikanan Dan Kelautan, Universitas Airlangga. Kampus C, Mulyorejo, Surabaya

Author-ID : 3288434

Agriculture, Biological Sciences & Forestry Arts Humanities Biochemistry, Genetics & Molecular Biology Earth & Planetary Sciences Education Engineering Environmental Science Immunology & microbiology Public Health Social Sciences Veterinary

Published : 60 Documents Claim Missing Document

Claim Missing Document

Articles

1 2 3 4 5

Gambaran Darah dan Histopatologi Insang, Usus Dan Otak Ikan Koi (Cyprinus carpio Koi) yang Diinfeksi Spora Myxobolus koi secara Oral [Haematology and Histopatology of Gills, Intestine And Brain Koi Fish (Cyprinus carpio Koi) Myxobolus koi Orally Infected] Gunanti Mahasri; Kusnoto Kusnoto; Era Insivitawati
Jurnal Ilmiah Perikanan dan Kelautan Vol. 7 No. 2 (2015): JURNAL ILMIAH PERIKANAN DAN KELAUTAN
Publisher : Faculty of Fisheries and Marine Universitas Airlangga

Abstract Koi fish (Cyprinus carpio koi) is one of the ornamental fish are preferred. One of the obstalces in the koi fish is a disease caused by infection myxobollus. This research to determine the effect of the infection myxobollus by oral in blood picture and histopathology. Haematology and histopathology is an indicator of the health of the fish to diagnose disease and to determine changes in the fish tissue. The research was conducted in Politeknik Kelautan dan Perikanan, dan Balai Karantina Ikan Kelas I, Juanda Surabaya from October to December 2014. This study uses the 5 treatments and 5 replications with different doses of infection (0,60,80,100 and 120 spora/fish). Data were analyzed with Annova haematology, followed by Duncan 5%. While histopathology were analyzed by semiquantitative scoring mothod used to determine the degree of histology Kluschal Wallis. The result showed that the haematology has significant result, white histopathology signify the presence of significant damage.

Potensi Serbuk Daun Pepaya untuk Meningkatkan Efisiensi Pemanfaatan Pakan, Rasio Efisiensi Protein dan Laju Pertumbuhan Relatif pada Budidaya Ikan Nila (Oreochromis niloticus) [Papaya Leaf Powder Potential to Improve Efficiency Utilization of Feed, Protein Efficiency Ratio and Relative Growth Rate in Tilapia (Oreochromis niloticus) Fish Farming] Gunanti Mahasri; Romziah Sidik; Norma Isnawati
Jurnal Ilmiah Perikanan dan Kelautan Vol. 7 No. 2 (2015): JURNAL ILMIAH PERIKANAN DAN KELAUTAN
Publisher : Faculty of Fisheries and Marine Universitas Airlangga

Abstract Tilapia is a fish that has high economic value and is an important commodity in the business world of freshwater fish. Some of the things that support the importance of commodities tilapia, among others, have a relatively high resistance to disease, have a wide tolerance to environmental conditions, has the ability to grow well and can thrive well in intensive farming systems. Feeding efficiency can reduce production costs, but still has the required nutritional value of fish is an alternative that should be pursued. Several methods are used to improve feed efficiency, including optimizing digestion and absorption of food and increase the efficiency of the protein with the addition of digestive enzymes. There are two types of digestive enzymes in the enzyme or enzymes endogeneous eksogeneous to help accelerate the process of digestion and hydrolysis. One eksogeneous enzyme is an enzyme papain. The purpose of this study is to analyze the improvement of the efficiency of feed utilization, increasing and enhancing the protein efficiency ratio relative to the growth rate of tilapia due to the addition of papaya leaf powder. The method used is a method laboratory experiments. While the research design used in this research is completely randomized design (CRD), with all the factors conditioning the same and homogeneous, except for the treatment factor. Treatments consisted of 3 treatments and repeated each 6 replications, namely: A1: treatment of feeding with powdered papaya leaves 2%, A2: treatment of feeding with powdered papaya leaves 3%, A3: treatment of feeding with powdered leaves of papaya 4% and C: feeding without addition of the enzyme papain (control). The main parameters in this study is the efficiency of feed utilization, protein efficiency ratio of the feed rate relative pertumhuhan on tilapia, fish protein in meat and fish meat thickness. Fish feed without the addition of the enzyme papain proximate tested. Once given the addition of papaya leaf powder, tested proximate feed back. The amount of feed intake was calculated by weighing the amount of feed that has been consumed during treatment (30 days). The research result analysis showed that papaya leaf powder addition of as much as 2% can improve the efficiency of feed utilization in tilapia fish farming amounted to 36.65%, can increase the protein efficiency ratio amounted to 0.55%, could increase the growth rate relative to the cultivation of tilapia by 2,725% , can increase the protein content in the flesh of tilapia by 17.98%. As for the treatment of papaya leaf powder addition of as much as 3% can increase the thickness of the flesh of tilapia by 38.09%

Ibm Bagi Petambak Udang Tradisional di Desa Pangkah Wetan, Kecamatan Ujung Pangkah, Kabupaten Gresik, yang Mengalami Gagal Panen Secara Terus Menerus [ Ibm for Traditional Shrimp Farmers in Pangkah Wetan Village, Ujung Pangkah District, Gresik Region, That Fail Harvesting In Continuoesly] Sudarno Sudarno; Gunanti Mahasri; Kismiyati Kismiyati
Jurnal Ilmiah Perikanan dan Kelautan Vol. 7 No. 1 (2015): JURNAL ILMIAH PERIKANAN DAN KELAUTAN
Publisher : Faculty of Fisheries and Marine Universitas Airlangga

Abstract Tiger shrimp (Penaeus monodon Fab) is one of the economically important shrimp, until 1992 became the most important of non petroleum export commodity from fishery sector. Since the end of 1993 up to now, the Penaeus monodon Fab death level has been relatively high and due to this circumstance have been caused many ponds collapsed so that the shrimp production was dramatically declined for year by year. Ujung Pangkah District is one of the Gresik Region areas which have big fisheries potensial, aspecially for the breakist water pond, that the topest as the other district. There are a lot of shrimp dead casis until now. But, so that 80% of breakist water pond were broken and not operational. The objective of this societies service activities is applicated a new shrimp culture technology with traditional plus probiocirculation system (PBS) for increases the shrimp harvest at Ujung Pangkah District Region of Gresik, from May until Oktober 2014. The method using in the activity were socialitation/counseling, dempond and guiding to application of the PBS model in one period. Monitoring and evaluation about this result were done in one month after the activity ending. This result showed that a positive indication. There was the knowledges of the farmer inceases by socialitation, it also applicated a model in the right method for shrimp culture. There were also showed that the PBS model can in ceased the shrimp harvest from 217 kg/ha to 872 kg/ha, it means was increased 303,7%. The conclution of this activity is the PBS model can used for breakist water pond idle revitalitation to increased the shrimp harvest and can applicates in more larges area in Gresik Region.

Efektivitas Vaksinasi Crude dan Soluble Protein Spora Myxobolus Koi terhadap Tingkat Kerusakan Usus Ikan Koi (Cyprinus carpio Koi) [ The Effectivety Crude and Soluble Protein of Myxobolus Koi Spore againts Intestine Different Degrees in Koi (Cyprinus carpio Koi)] Gunanti Mahasri; Rachma Woro Anggarani; Lucia Tri Suwanti
Jurnal Ilmiah Perikanan dan Kelautan Vol. 7 No. 1 (2015): JURNAL ILMIAH PERIKANAN DAN KELAUTAN
Publisher : Faculty of Fisheries and Marine Universitas Airlangga

Abstract Myxobolus koi is one species of Myxobolus sp that can cause parasitic diseases in fish called Myxobolusis. Based on the Decree of the Minister of Marine and Fisheries No: KEP.03/MEN/2010 that Myxobolus koi in the list of Fish Quarantine Pests group I. Myxosporean diseases are most numerous in the water can cause Proliferative Kidney Disease (PKD) and Whirling Disease (WD). The aim of this research is to finding, analyzing and determining the protein of spores Myxobolus koi that can effectively reduce the level of damage to the intestinal organs as well as for the prevention myxobolusis on Koi’s. Then for finding, analyzing and determining the protein of spores Myxobolus koi do isolation of spore proteins. The study consisted of three phases examination to preparation and identification of spores, isolation and analyze of crude and soluble protein spores for obtain dose and molecular weight each protein and histopathological test. This research uses descriptive method. The data presented may be narratives, images, tables or charts for each group. Intestinal histopathology test results of research carried scoring Koi’s were analyzed using the Kruskal-Wallis. The results showed a profile crude protein and soluble proteins from spores Myxobolus koi showed that the molecular weight of crude protein Myxobolus koi in this study was 150 kDa and 72 kDa and for soluble protein was 73 kDa. Results scoring the degree of infection caused by exposure to Myxobolus koi then statistically processed with an average yield of scoring in a sequence of 0; 1.6; 0.64 and 0.32. Statistical analysis showed no significant difference in the treatment of K + with crude protein, and K + with soluble proteins. Statistical analysis showed that there were significant differences in treatment with K+ and K-, K- with soluble protein and crude protein and soluble protein. Histopathological changes in the intestine in the form of inflammatory cell infiltration, necrosis and haemorage

Prevalensi dan Tingkat Kelulushidupan Ikan Mas (Cyprinus carpio) yang Diuji Tantang dengan Protein Spora Utuh Myxobolus Koi Di Tambak [ Prevalence and The Survival Rate Of Gold Fish (Cyprinus carpio Linn) that Challenced Whole Protein Spore Myxobolus Koi in Pond] Gunanti Mahasri; Nedi Nedi; Mufasirin Mufasirin
Jurnal Ilmiah Perikanan dan Kelautan Vol. 7 No. 1 (2015): JURNAL ILMIAH PERIKANAN DAN KELAUTAN
Publisher : Faculty of Fisheries and Marine Universitas Airlangga

Abstract One of parasite disease that often outbreak is protozoan disease that caused by Myxobollus koi, that recaqniced Myxobolusis. Starting at 2009 this disease included in fish quarantine disease, because it can caused fish sick and dead. This disease can to be big problem in aquaculture, it can caused mortality 60-90%, with the prevalence reach 100%. In 1974 and 1978 the myxobolusis case happened in Indonesia and it caused mortality antil 100% in seed stadium. The aims of this Research are to detect the prevalence of the gold fish (Cyprinus carpio Linn) that infected by Myxobolus koi that challence by spora protein of Myxobolus koi in pond and want know abaout the survival rate of gold fish (Cyprinus carpio Linn) that challence by protein spora of Myxobolus koi in pond. This Research is field experiment that consist to 4 group, this are : KP1= Controle (No challence by protein spore and nor infected by Myxobolus koi) ; KP2 = challence by protein spore and infected by the dose 600 µl/l/one fish and infeted by Myxobolus koi dengan with dose 80 spore / liter, KP3 = No challence by Protein spore with dose 600 µl/l/one fish and was infected by Myxobolus koi with dose 80 spore / liter and KP4 = challence with Protein spore and not infcteted by Myxobolus koi. The result showed that the highest prevalence 74% found on gold fish that infected by Myxobolus koi and not dipping by whole protein spore before scatter in pond and in 60 days age. Whole Protein spore of Myxobolus koi can be decreased the prevalence of the gold fish (Cyprinus carpio Linn) infected by Myxobolus koi in pond 47,8% for 30 days age, 62,1% for 60 days and 69% for 90 days age in pond. The Whole Protein spore of Myxobolus koi also can increased the survival rate of gold fish (Cyprinus carpio Linn) in pond from 29% to 81%, it means that whole protein spore can increased in 179,3%.

Peningkatan Nilai Nutrisi Pollard melalui Fermentasi Ragi Tempe sebagai Bahan Pakan Buatan Ikan Nila (Oreochromis niloticus) [ Increased Nutritional Value Pollard Through Yeast Fermentation Tempe as Artificial Feed Ingredients Tilapia (Oreochromis niloticus)] Gunanti Mahasri; Miftakhul Munir; Romziah Sidik
Jurnal Ilmiah Perikanan dan Kelautan Vol. 7 No. 1 (2015): JURNAL ILMIAH PERIKANAN DAN KELAUTAN
Publisher : Faculty of Fisheries and Marine Universitas Airlangga

Abstract Tilapia (Oreochromis niloticus) is a type of fish that is easily cultivated in various places (pond, floating cage and rice fields). Pollard is an alternative feed ingredients that have great potential, both as a source of energy, crude fiber source, or sources other macro nutrients. Mold in fermentation used and contributes to a feed enzymes that help digestion and to penetrate into the network feed that network structure becomes brittle and breaks down and the surface becomes more widespread. more surface enables direct contact with digestive enzymes cellulose greater. The results of the analysis of the nutrient content of food research trials show that using tempeh fermentation pollard 0.2% can increase the nutritional value of protein pollard 14.88%. Pollard tempeh fermentation using 0.2% can improve the digestibility of crude fiber and digestibility of dry matter pollard. Feed consumption of tilapia in the treatment using fermented tempeh pollard 0.2% is not significantly different from the commercial feed. Pollard tempeh fermentation using 0.2% to 16.98% protein content can increase the growth rate of tilapia.

Analisis Respons Imun Ikan Koi (Cyprinus carpio Koi) yang Divaksin dengan Whole Protein Spora Myxobolus koi sebagai Kandidat Vaksin Myxobolusis [ Immune Response Analysis of Fish Koi (Cyprinus carpio Koi) Vaccinated Myxobolus Koi Spores Whole Protein as Vaccine Candidate Myxobolusis] Gunanti Mahasri; Mohamad Yusuf; Mufasirin Mufasirin
Jurnal Ilmiah Perikanan dan Kelautan Vol. 7 No. 1 (2015): JURNAL ILMIAH PERIKANAN DAN KELAUTAN
Publisher : Faculty of Fisheries and Marine Universitas Airlangga

Abstract Myxobolus is one of parasites on koi fish that belongs to a class myxosporea that can infect and systemic and can cause harm to the fish farming. Vaccination is an attempt to cause-specific endurance through vaccination. Observations differential leukocytes and increased optical density values can be used to determine the effectiveness of the vaccine is given. This study aims to analyze the immune response koi fish vaccinated with Myxobolus koi spores whole protein for vaccine development myxobolusis in koi fish. The method used in this study is Completely Randomized Design with 4 treatments and 5 replications. The results showed that a change in the total number and types of leukocytes that can be used as indicators of the presence of certain infectious diseases that occure in fish. The highest value of lymphocytes in treatment B, monocytes highest in treatment D, neutrophils on treatment D, eosinophils on treatment A and basophils highest in treatment A. The observation of the highest optical density value in treatment B (fish vaccinated and infected 80 M. koi spores / tail) of 0.593 at day 30, while the lowest in treatment D (fish are not vaccinated but diinveksi 80 M. koi spores / tail) of 0,064 in 30 days

Peningkatan Hasil Panen Udang pada Budidaya Udang Tradisional di Desa Permisan Kecamatan Jabon Kabupaten Sidoarjo untuk Mengurangi Waktu Panen Menggunakan Metode Best Management Practice (BMP) [To Increases The Shrimp Harvesting in Traditional Shrimp Farmer in Permisan Village, Jabon District, Sidoarjo Region Losted Harvesting for a Long Time by Using Best Management Practise (BMP) Method] Muhammad Arief; Gunanti Mahasri; Akhmad Taufiq Mukti
Jurnal Ilmiah Perikanan dan Kelautan Vol. 7 No. 1 (2015): JURNAL ILMIAH PERIKANAN DAN KELAUTAN
Publisher : Faculty of Fisheries and Marine Universitas Airlangga

Abstract Tiger Shrimp (Penaeus monodon Farb) is one of marine shrimps that have an important economically from fisheries sector. But since the end of 1993 up to now, there is high shrimp mortality that caused by the diseases andwater quality. It caused olmost the shrimp farmer lossed harvesting and due to this circumstance have been caused many ponds collapsed. The main objective of this societies service activities is applicated a new shrimp culture technology with traditional plus by using Best Management Practise (BMP), for increases the shrimp harvest at Permisan village, Region of Sidoarjo, it was done on May until October 2012. The method using in the activity were socialitation/counseling, dempond and guiding to application of the BMP Methode in one periode. Monitoring and evaluation about this result were done in one month after the activity ending. The result showed that a positive indication. There was the knowledges of the farmer in ceases by socialization, it also applicated a model in the right method for shrimp culture. There were also showed that the BMP Methode can inceased the shrimp harvest from 267 kg/ha to 903,652 kg/ha, it means was increased 276, %. The conclution of this activity is the BMP Methode can increased the shrimp harvest and can applicates in more larges area in Sidoarjo Region.

Keragaman Gen Cytochrome B pada Sidat (Anguila bicolor) Berdasarkan Restriction Fragment Length Polymorphism (RFLP) [Genetic Diversity Cythochrome B of Sidat (Anguila bicolor) Assesed by Restriction Fragment Length Polymorhisme (RFLP) ] Gunanti Mahasri; Lestari Wilujeng; Mufasirin Mufasirin
Jurnal Ilmiah Perikanan dan Kelautan Vol. 6 No. 2 (2014): JURNAL ILMIAH PERIKANAN DAN KELAUTAN
Publisher : Faculty of Fisheries and Marine Universitas Airlangga

Abstract This study aims to analyze the genetic character of Anguilla bicolor based on cytochrome b gene as the basis of information in the study of phylogeny and genetic engineering. The research was conducted from May to September 2013 in the Laboratory of Biotechnology Faculty of Science, University of Brawijaya. This study uses a survey with qualitative descriptive analysis in the laboratory. Samples obtained from direct arrests in Tulungagung Popo Beach , Manado , Medan and Cilacap. Study was initiated by DNA isolation using CTAB method and followed by PCR . Primers used were cytb - 1 (5' - TGCTAACGATGCCCTAGTGG - 3 ') and b CYT - 2 (5' - CTAGTCAACCTACT - AATGGG - 3 ') . PCR results were cut using restriction enzymes and Msp1 Hha1. Data analysis was performed with the aid of NTSYS software program. Genetic character of a sequence of nucleotide bases making up DNA from the cytochrome b gene were obtained on each sample has a degree of similarity around 32 - 100 %.

Ibm Bagi Petani Benih Udang Windu Skala Rumah Tangga (Backyard) Di Desa Kalitengah Kecamatan Tanggulangin Sidoarjo Yang Mengalami Gagal Panen Berkepanjangan Karena Serangan Penyakit [Ibm For Seed Shrimp Farmers Family Scale (Backyard) In Kalitengah Village, Tanggulangin District, Sidoarjo Region, That Harvesting Lossed To Long Times That Caused By The Diseases] Gunanti Mahasri; Sudarno Sudarno; Endang Dewi Masithah
Jurnal Ilmiah Perikanan dan Kelautan Vol. 6 No. 1 (2014): JURNAL ILMIAH PERIKANAN DAN KELAUTAN
Publisher : Faculty of Fisheries and Marine Universitas Airlangga

Abstract Demand of seed shrimp, as specially tiger shrimps is still not enough until now, it is only 5060%, more than for 5-10 years end showed decreased point. One of factors that influenced the successfully seeds shrimp hatchery is water quality that as a life media of shrimps. A bisnis about shrimp hatchery is still have a good market, because there are a lot of tiger shrimp pond operational, more than some time demand of the shrimp increase fluctuative on seasonal. The aims of this this societies service activities is applicated a new shrimp hatcher technology by using immunostimulant at Putri Mandiri Group company, it aplicated in family hatcher in Kalitengah village, Tanggulangin District, Region of Sidoarjo. The immunostimulant use to increase the body deffence of the shrimp larve in hatchery to the disease attacked dan invirontment during culture periode, it will be increase the harvesting. The method using in the activity were socialitation/counseling, dempond and guiding to application of the method of shrimp hatcher by using immunostimulant in one periode. Monitoring and evaluation about this result were done in one month after the activity ending. This result showed that aplicated immunostimulant in shrimp family hatcher Backyard) can increased the shrimp seed harvesting of Putri Mandiri Company owner, from 900.000 to 1.600.000 shrimp seeds, it is same as that the profit increased from 8.622.000,- until 15.822.000,- Rupiahs for one periode panen for one container 10 tonage capacity.

Co-Authors A. Shofy Mubarak Abdul Manan Abyan Farras Adamu Ayubu Mwendolwa Adamu Ayubu Mwendolwa Adiacahya, Eren Aditya Gita Rohmatullah Agung Pamuji Rahayu Agus Nazarudin Yahya Akhmad Taufiq Mukti Alfan Prianggara Alim Isnansetyo Almira Fardani Lahay Alvira Febrianti Pratiwi Anggun Nurani Citrowati Anord Charles Nkuba Ardilas Heryamin Arika Juniarsih Arya Witantama Berliana A Bidayatul Afifah Boedi S. Rahardja Boedi Setya Rahardja Browijoyo Santanamurti Cintia Larasati DARMAWAN SETIA BUDI Desak Ketut Sekar Cempaka Putri Dewi, Nina Nurmalia Dieswinta Hardika Aris dika dika Endah Sih Prihatini Endang Dewi Masithah Era Insivitawati Ewang Mahendra Putra Fahdi Putra Utama Faisol Mas'ud Ferry Dwi Firmansyah Liananda Firly Waliani Rahma Fuquh Rahmat Shaleh Hari Suprapto Ikmalia A Indah Hidayati Imani Iqbal Ghazali Irvansyah Irvansyah Kadek Racmawati Kismiyati , Koesnoto Koesnoto Kusnoto Kusnoto Laksmi Sulmartiwi Laksmi Surmartiwi Lestari Wilujeng Linnya Prima Agustin Lucia Tri Suwanti, Lucia Tri Luthfiana Aprilianita Sari Lyla Wulandari M Ervany Eshmat Miftakhul Munir Moch Saad Mochammad Dwi Hardhianto Mohamad Yusuf Mohammad Faizal Ulkhaq Mufasirin Muhamad Amin Muhammad Arief Muhammad Herman Nafis Putra Laksana Cholil Nanuk Qomariyah Nedi Nedi Niluh Suwasanti Norma Isnawati Nunuk Dyah Retno Lastuti Nur Fais Nurlita Abdulgani Nurul Kumalasari Prayogo Prayogo Pristita Widyastuti Rachma Woro Anggarani Rahayu Kusdarwati Riris Ulfiana Riza Aryani Romziah Sidik Rozi Rozi Santanumurti, Muhammad Browijoyo Sari, Putri Desi Wulan Setiawan Koesdarto Siti Hamidah Sri Mulyati Sri Subekti Sudarno Sudarno Sudarno Sudarno Sudarno Sudarno Suzanita Utama Titom Gusmana Putra Perdana Ulia Fajriah Wahyu Isroni Woro Hastuti Setyantini Wurlina w Yunifar Amad

Title

Found 60 Documents
Search

Abstract

Abstract

Abstract

Abstract

Abstract

Abstract

Abstract

Abstract

Abstract

Abstract

Title Search

Found 60 Documents Search

Abstract

Abstract

Abstract

Abstract

Abstract

Abstract

Abstract

Abstract

Abstract

Abstract

Title

Found 60 Documents
Search