p-Index From 2017 - 2022
7.046
P-Index
This Author published in this journals
All Journal Journal of Food and Sciences Katalogis MOTION : Jurnal Riset Physical Education Interaksi : Jurnal Ilmu Komunikasi Jurnal Pendidikan Matematika dan IPA Buletin Al-Turas Jurnal Kreatif Tadulako Online Dinamika Hukum El-HARAKAH : Jurnal Budaya Islam AdMathEdu : Jurnal Ilmiah Pendidikan Matematika, Ilmu Matematika dan Matematika Terapan Pharmaciana: Jurnal Kefarmasian Jurnal Ilmiah Kesatuan (JIK) Edukasi JEJAK Students´ Journal of Economic and Management AGRIVITA, Journal of Agricultural Science Kajian Linguistik dan Sastra JURNAL PHARMASCIENCE Wahana Teknik Sipil: Jurnal Pengembangan Teknik Sipil EDU-MAT: Jurnal Pendidikan Matematika BERITA BIOLOGI Kultivasi Titian Ilmu: Jurnal Ilmiah Multi Sciences PALAPA: Jurnal Studi Keislaman dan Ilmu Pendidikan Tawarikh : Journal of Historical Studies Syntax Literate : Jurnal Ilmiah Indonesia Prosiding Seminar Nasional Teknoka Buletin Sumber Daya Geologi Civic-Culture : Jurnal Ilmu Pendidikan PKN dan Sosial Budaya Beta: Jurnal Tadris Matematika Jurnal Penamas Adi Buana WAHANA Jurnal Kolaboratif Sains Sainmatika: Jurnal Ilmiah Matematika dan Ilmu Pengetahuan Alam Journal of Tropical Pharmacy and Chemistry JURNAL MERCATORIA Edumaspul: Jurnal Pendidikan Indonesian Journal on Learning and Advanced Education (IJOLAE) Jurnal Pendidikan Jurnal Agrotek Lestari Diligentia: Journal of Theology and Christian Education JATI EMAS (Jurnal Aplikasi Teknik dan Pengabdian Masyarakat) JPP (Jurnal Pendidikan dan Pembelajaran) JURNAL EDUKASI NONFORMAL JIIP (Jurnal Ilmiah Ilmu Pendidikan) Budapest International Research and Critics Institute-Journal (BIRCI-Journal): Humanities and Social Sciences Edudikara: Jurnal Pendidikan dan Pembelajaran Jurnal Akrab Juara JP Proceeding Biology Education Conference Tarjih Tropical Livestock Journal KARYA: Jurnal Pengabdian Kepada Masyarakat Abdimas Langkanae: Jurnal Pengabdian kepada Masyarakat Jurnal Kolaboratif Sains Ophthalmologica Indonesiana
Claim Missing Document
Check
Articles

AKUNTABILITAS PENGELOLAAN DANA TUGAS PEMBANTUAN PENYEDIAAN AIR MINUM SANITASI TOTAL BERBASIS MASYARAKAT (PAM-STBM) DI DINAS KESEHATAN KABUPATEN SIGI Suparman, Suparman
Katalogis Vol 6, No 2 (2018)
Publisher : Katalogis

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (300.375 KB)

Abstract

The research aims to determine and analyze the accountability of fund Management of Community-Based Total Sanitation Drinking Water Supply in Health Department of Sigi District and determine and analyze the cause of absorption of fund for Community-Based Total Sanitation is not 100%. To achieve those aims, the research components are divided into for aspects, namely: preparation, planning, implementation, and the stage of accountability. Type of research is qualitative descriptive with phenomenological approach. Data collecting method is in-depth interview on six informants and secondary data is taken from monthly, semester, and yearly reports. The result highlights that the analysis of fund management of community-based total sanitation drinking water supply in Health Department of Sigi District from preparation planning, implementation, and the stage of accountability has been well-implemented; then, some causes of fund absorption does not reach 100%, among other, due to the remaining honorarium of working unit, the remaining travel expenses, third party waste, and the remaining funds due to a cancellation of one auction package.
IMPLEMENTASI METODE BOOTSTRAP UNTUK PENGUJIAN HIPOTESIS MENGENAI DUA MEAN POPULASI Suparman, Suparman
Jurnal Ilmiah AdMathEdu Vol 2, No 1 (2012): Juni
Publisher : Universitas Ahmad Dahlan

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (135.419 KB)

Abstract

This paper examines the problem of testing hypotheses about two population means. Most testing hypotheses about two population means, based on the assumption that each random sample drawn from a normal population. In this paper studied the problem of testing hypotheses about two population means are not using the assumption of normality and homogeneity. The method used to test hypotheses about two population means are the bootstrap method. The basic idea of the bootstrap method of repeated sampling with replacement from the sample data. Replication of samples used to determine the point estimator of Achieved Significance Level (ASL). Performance of the bootstrap method was tested using simulated data. The test results show that the bootstrap method to test the hypothesis of two population means well. Furthermore bootstrap method implemented on real data.
Pengendalian Tenaga Kerja Dengan Menggunakan Teori Antrian di PT. BANK NISP Tbk. Cabang Kesatuan Bogor Suparman, Suparman
Jurnal Ilmiah Kesatuan (JIK) Vol 5, No 2 (2003): Jurnal Ilmiah Kesatuan
Publisher : STIE Kesatuan

Show Abstract | Download Original | Original Source | Check in Google Scholar

Abstract

Pengendalian tenaga kerja pada suatu bank sangatlah penting, karena berhubungan langsung dengan pelayanan konsumen. Untuk itu suatu bank harus benar-benar memperhatikan pola antrian yang terjadi dari konsumen yang ingin dilayani. Dalam hal ini tentu harus diperhatikan antara ekstra biaya yang dikeluarkan perusahaan untuk menambah fasilitas layanan baru dengan kerugian-kerugian konsumen karena menunggu apabila tidak diadakan penambahan fasilitas pelayanan yang baru. Penelitian ini dilaksanakan untuk menjawab beberapa pertanyaan sebagai berikut. Bagaimana tingkat pelayanan yang terjadi (yang ada) di Bank NISP Cabang Bogor? Bagaimana karakteristik antrian pada Bank NISP? Bagaimana sebaiknya tingkat pelayanan pada Bank NISP? Dengan menghitung rata-rata nasabah yang dilayani bagian kasir menggunakan model antrian yang sudah ada, maka diperoleh jawaban atas pertanyaan tersebut. Hasil penelitian menunjukkan bahwa PT. Bank NISP Tbk. cabang Kesatuan Bogor memiliki struktur atau layout dari jumlah antrian adalah tunggal atau single dan saluran (channel) adalah 3, berarti lebih dari satu (multiple). Tingkat pelayanan yang diberikan adalah tunggal atau single. Dengan demikian struktur dan tingkat pelayanan di PT. Bank NISP Tbk. Adalah “Multi Channel Single Phase“. Untuk dapat mengetahui karakteristik antrian Bank NISP Cabang Kesatuan Bogor, selain data kedatangan nasabah diperlukan juga informasi mengenai biaya-biaya yang relevan dengan permasalahan yaitu Biaya fasilitas pelayanan dan biaya menunggu. Kata kunci: Manajemen operasi, layanan bank, nasabah, teori antrian.
Economical Impacts of MOdernization on the Tappers of Ahmad Tohari's Bekisar Merah Suparman, Suparman
Buletin Al-Turas Vol 14, No 1 (2008): Buletin Al-Turas
Publisher : Fakultas Adab dan Humaniora, UIN Syarif Hidayatullah Jakarta, Indonesia

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (1693.084 KB) | DOI: 10.15408/bat.v14i1.4249

Abstract

This literary research is primariw aimed at revealing the economical impacts of modemizabon on the tappers in Bekisar Merah. The study uses terdisciplinary approach, which involves economical historical, cultural, ecological, and mimetic approaches. The analysis shows that the forms of modernization in Bekisar Merah are the impacts of the coming of electrification in the village. Modernization does not only cause positive impacts but also negative ones, which are stronger. The negative impacts include monopoly, human andcultural conflict, poverty, disharmony, greediness, law breaking, materialistic life, adultery, divorce, less religiosity, drop outs and migration. The positive impacts indude independence, adaptation, rationality,and efficiency. The problems appear in the novel rellects the inner conflict of the author, Ahmad Tohari He questions the ideas of the coming of electricity set in Karangsoga villase. Modernization can only be enjoyedby the upper class of the society. It cannot meet the nenes sity of the common people. The tappers loose somebenefits because of the coming of electricity in their village. They cannot enjoy the electricity, moreover, it caused misery and poverty.
PENGARUH KOMPETENSI , DISPLIN KERJA TERHADAP KINERJA DIMEDIASI KOMITMEN ORGANISASIONAL (Pada SMP Negeri Di Kabupaten Pati) Suparman, Suparman
Students Journal of Economic and Management Vol 1, No 1 (2012): VOL. 1 NO. 1 EDISI PERTAMA 2012
Publisher : Students Journal of Economic and Management

Show Abstract | Download Original | Original Source | Check in Google Scholar

Abstract

The purpose of this research was to examine the influence ofTeachers’ competence and Discipline toward Performance with Organizational commitment as mediation (Study at Secondary Schools Teachers in Pati Regency). The population in this research is all Junior High School Teachers of Civil Servants (PNS) in  Pati regency. Sample method applies Stratified Proportional Random Sampling using Slovin. The data are collected from 206 respondents by using sampling method.The instrument which is used in this research is computer software SPSS ver.16. program. Method of analyses to used linier regression analyses by conducting test of classic assumption and 5 hypothesis. The results of this research showed that the variables of Teacher Competency has a positive influence on Organizational Commitment, Discipline teachers have a positive effect on organizational commitment, competence of teachers has a positive influence on the performance of teachers, discipline has a positive impact on teacher performance, organizational commitment has a positive influence on the performance of teachers. And as a mediation, commitment organizational can’t be proved. It shows that commitment organizational can’t  mediate the influence of both competence and discipline toward teachers’ performance of junior high school teachers in Pati regency. Keywords: Teacher competence, discipline, Organizational Commitment, performance  teacher
DESAIN PRIMER PCR SECARA IN SILICO UNTUK AMPLIFIKASI GEN COI PADA KUPU-KUPU Papilio ulysses Linnaeus DARI PULAU BACAN Suparman, Suparman
Jurnal Pendidikan Matematika dan IPA Vol 7, No 1 (2016): Januari 2016
Publisher : Universitas Tanjungpura

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (426.923 KB) | DOI: 10.26418/jpmipa.v7i1.17341

Abstract

The insillico research was conducted to produce primer sequence of COI gene in Butterfly species Papilio ulyses from Bacan Island that will be used in gene isolation. The COI sub-unit I is a barcode gene that generally have special purposes in animal identification. It is also available in phyilogenetic analysis. The first step of method is downloading the COI DNA sequence of Papilio ulysses from GeneBank (NCBI). Then the conserve region of COI sequence is identified to determine primer. Primer is designed with primer designer software (Genamics Expression) in two direction of DNA reading frame that are : forward primer (COI Pu-F) and reverse primer (COI Pu-R). The last step is primer confirmation with primer blast tool in NCBI. Primers of COI gene that are produced consist of two, that are CGAAAATGACTTTATTCAACA for forward primer (COI Pu-R) and AGCAGTAATTCCAACAGCTC for reverse primer (COI Pu-R). The optimal temperature of annealing is from 50,740 to 55,740 Celsius with PCR product around 567 base pair long. Key Words : PCR primer, in silico, COI gene, Papilio ulysses, Bacan island.
Meningkatkan Hasil Belajar Siswa Pada Pelajaran IPA Melalui Media Gambar Di Kelas II SDN 03 Lakea Kab. Buol Suparman, Suparman; Nurdin, Hj. Musdalifah; Tiwow, Vanny M.A
Jurnal Kreatif Tadulako Online Vol 5, No 3 (2017): Jurnal Kreatif Tadulako Online
Publisher : Jurnal Kreatif Tadulako Online

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (176.042 KB)

Abstract

Penelitian ini dilatar belakangi rendahnya hasil belajar siswa. Hasil belajar yang diperoleh siswa, yaitu rata-rata hasil ulangan harian siswa tahun ajaran 2012/2013 adalah 6,0. Penelitian ini bertujuan untuk meningkatkan hasil belajar siswa pada pelajaran IPA dengan menggunakan media gambar di kelas II SDN 03 Lakea Kab. Buol. Jumlah siswa sebanyak 30 orang. Penelitian ini adalah penelitian tindakan kelas yang terdiri atas dua siklus. Rancangan penelitian mengikuti tahap penelitian yang mengacu pada modifikasi diagram Kemmis dan Mc. Taggart, yaitu 1) Perencanaan tindakan, 2) Pelaksanaan tindakan, 3) Observasi, dan 4) Refleksi. Teknik pengumpulan data yang digunakan adalah lembar observasi guru, lembar observasi siswa, lembar kerja siswa (LKS), dan tes hasil belajar siswa. Hasil penelitian menunjukkan bahwa terjadi peningkatan hasil belajar, dari siklus I ke siklus II. Hasil persentase ketuntasan klasikal 76,7% pada siklus I meningkat menjadi 90% pada siklus II. Demikian pula peningkatan rata-rata hasil belajar dari 7,2  pada  siklus  I menjadi 8,1  pada  siklus  II, serta persentase rata-rata aktivitas guru pada siklus I adalah 65,4% menjadi 86,6% dengan kriteria baik dan aktivitas siswa diperoleh persentase rata-rata 61% pada siklus I menjadi 85% dalam kriteria baik. Berdasarkan hasil penelitian menunjukkan bahwa penggunaan media gambar pada pelajaran IPA dapat meningkatkan hasil belajar siswa kelas II SDN 03 Lakea Kab. Buol. Kata Kunci: Hasil Belajar, Media Gambar
Coorporate Social Responsibility : Bentuk Tanggung Jawab Sosial dan Kepedulian Perusahaan dengan Masyarakat Suparman, Suparman
Interaksi: Jurnal Ilmu Komunikasi Vol 2, No 2 (2013): July 2013
Publisher : Master of Communication Science Program, Faculty of Social and Political Science, Diponego

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (565.474 KB) | DOI: 10.14710/interaksi.2.2.172-184

Abstract

Abstract :Corporate Social Responsibility is performed as an institution’s planned, active, and continuing participation with and within a community to maintain and enhance its environment to the benefit of both the institution and the community. Community relations will reduce conflict and help to discover the best policy that lead to well being community throught the establishment of social capital as part of corporate social responsibility. At the macro level, the system approach and communitarian approach give perspectives to explain the interaction between organization with is environment. At the mezzo level, the corporate social responsibility shoult be supported by its function in organization. Finally at the micro level, public relations practitioners should take a signifikant role in organizationKey words : corporate social responsibility, system approach, social responsibility, public relationsAbstraksi :Tanggung Jawab Sosial Perusahaan dilakukan seperti apa yang telah direncanakan lembaga, bersifat aktif dan partisipasi dalam masyarakat untuk mempertahankan serta meningkatkan lingkungan untuk kepentingan antara lembaga dan masyarakat. Hubungan masyarakat akan mengurangi konflik dan membantu untuk menemukan kebijakan yang terbaik dan mengarah pada kesejahteraan masyarakat seperti pembentukan modal sosial sebagai bagian dari tanggung jawab sosial perusahaan. Pada tingkat makro, pendekatan sistem dan pendekatan komunitarian memberikan perspektif untuk menjelaskan interaksi antara organisasi dengan lingkungan adalah sangat penting. Pada tingkat meso bersifat operasional dan disesuaikan dengan kondisi perusahaan sehingga tanggung jawab sosialnya didukung oleh fungsinya dalam organisasi. Namun pada tingkat mikro, prkatisi public relations harus mengambil peran secara signifikan dalam organisasi perusahaan.Kata Kunci : Tanggung Jawab Sosial perusahaan, Pendekatan Sistem, Tanggung Jawab, Public Relations
AMERICAN ENSLAVEMENT AS SEEN IN NARRATIVE OF THE LIFE OF FREDERICK DOUGLAS & IN THE INTERESTING NARRATIVE OF THE LIFE OF OLAUDAH EQUIAO Suparman, Suparman
Kajian Linguistik dan Sastra Vol 17, No 2 (2005)
Publisher : Universitas Muhammadiyah Surakarta

Show Abstract | Download Original | Original Source | Check in Google Scholar | DOI: 10.23917/kls.v17i2.4515

Abstract

Mimetic approach is used in this study to reveal the practice of slavery depicted in two novels "narrative of the Life of Frederick Douglas" and "The Interesting Narrative of the life of Olaudah Equiao". The findings show that novels have common ground that is the practice of the slavery of blacks Africans by the whites in America. In some aspects, the slaveholders treated their slave inhumanly, savagely, and brutally. The slaves were really treated like animals in the ways of providing them food, shelter. clothes, and dispensation of rest. They were forbiden to learn of how to write and read. They were forced to work hard without having enough rest. However, when they got wage, they had to give it to their masters. Female slaves were whipped and tortured savagely, and their children were tortured to death. These are the examples of the brutality of the slaveholders.Key words: slavery, slaveholders, slaves, inhumanity, discrimination, and oppression 
Hubungan Kuantitatif Struktur-Aktifitas dan Doking Molekular Senyawa Meso-Tetraphenylporphyrin dan Meso-Tetraphenylchlorin sebagai Fotosensitizer untuk Terapi Fotodinamik Djalil, Asmiyenti Djaliasrin; Saputri, Nurul Fadhilah Deni; Suparman, Suparman; Hamad, Alwani
JURNAL PHARMASCIENCE Vol 3, No 1 (2016): JURNAL PHARMASCIENCE
Publisher : JURNAL PHARMASCIENCE

Show Abstract | Download Original | Original Source | Check in Google Scholar

Abstract

Terapi fotodinamik (Photodynamic Therapy/PDT) merupakan metode alternatif pengobatan kanker yang selektif. Terapi ini memerlukan fotosensitizer yang diberi penyinaran dalam lingkungan oksigen sehingga dihasilkan oksigen singlet yang mampu menghancurkan sel kanker dan merusak jaringan. Meso-tetraphenylchlorin (MTPP) dan meso-tetraphenylporphyrin (MTPC) adalah fotosensitizer yang memiliki struktur molekul yang mirip, hanya berbeda kejenuhan pada satu cincin pirolnya. MTPP adalah tetrapirol makrosiklik dengan cincin pirol tidak tereduksi sedangkan struktur MTPC tereduksi pada salah satu cincin pirolnya. Penelitian ini bertujuan untuk memprediksi hubungan antara struktur tetrapirol makrosiklik terhadap aktivitasnya secara in silico. Analisis hubungan kuantitatif-struktur aktifitas (HKSA) menggunakan serangkaian senyawa turunan porfirin dilakukan untuk memperoleh persamaan yang secara statistik memiliki kemampuan korelatif dan prediktif. Perangkat lunak Molecular Operating Environment (MOE) digunakan untuk melakukan analisis HKSA. Doking molekul dilakukan terhadap human serum albumine (HSA) dan  peripheral benzodiazepine receptor (PBR) untuk memperoleh energi doking yang berhubungan dengan energi afinitas antara ligan dan reseptor. Simulasi doking dilakukan dengan menggunakan perangkat lunak AutoDock. Hasil menunjukkan bahwa MTPC memiliki energi doking terhadap HSA dan PBR yang paling baik. Analisis HKSA yang diperoleh  menunjukkan bahwa MTPC lebih potensial sebagai fotosensitizer yang ditunjukkan dengan nilai IC50 yang lebih kecil.  Kata kunci: doking molekular, fotosensitizer, HKSA, MTPC, MTPP, PDT
Co-Authors A.S, Arif Efendi Achmad Hufad, Achmad Adithya Wahyu Pratama, Adithya Wahyu Agus Siswanto Agustang, Andi Ahmad, Harun Al Jupri Alesia, Monica Alwani Hamad Amar Akbar Ali, Amar Akbar Amitayani, Elok S Andri, Mohammad Andri, Mohammad Apaut, Vrijilio Aditia Asmiyenti Djaliasrin Djalil Astutik, Kasni Bahtiar . Bahtiar Bahtiar Beta, Pancana Bodja Suwanto, Bodja Busa, Yunus Chen, Jihe Darmawan, Epa Wira Dewi ANGGRAENI Dini Handayani, Dini Diniatik Diniatik Dwi Rahayuningsih Dwi Saesar Nur Syafril, Dwi Saesar Nur Edwin Musdi Effendi, Susril Dedi ELIHAMI, ELIHAMI Eni Suryani Firdaus, Dadan Gemini Alam Gita Srihidayati Hadi, Buyung A. Hardjo, Sri Harmini Harmini Hj. Musdalifah Nurdin Ibnu Amar, Ibnu Ibrahim Ibrahim Ika Yuni Astuti Junaedi Junaedi Khaeruddin Khaeruddin Komaratih, Evelyn M. A. Firmansyah M. Nasir Tamalene Madeamin, Sehe Marianti A. Manggau Megati, Yulius Christian Miswan Miswan Mufidah Mufidah Muh. Akbar Bahar, Muh. Akbar Mulyono, Tedjo Musthafa, Izzuddin Muzakir Muzakir Niar, Niar Noertjahyani Noertjahyani, Noertjahyani Nonong Amalita Nurcahyanie, Yunia Dwie Nurmadina, Nurmadina Nurul Fadhilah Deni Saputri, Nurul Fadhilah Deni Nuryanti Nuryanti Oruh, Shermina parman parman Rahmah, Mufti Hatur Razak, Razman Rihardini, Listya Dyah Rokhmiati, Rokhmiati Safrida Safrida Saharuddin, Andi Saidang, Saidang Saidang, Saidang Samsul, Putriyani Setiadi, Dali SITI HERLINDA Sitompul, Kristian B. Sriwulandari, Yunita Anas Subhan Purwadinata, Subhan Subowo Subowo Suharyanto sukri Sukri, sukri Sulasman Sulasman Supardjo Supardjo supriadin supriadin Suwandi Suwandi Suyono Suyono Tallesang, Mukhtar Tamur, Maximus Tjiptasurasa Tjiptasurasa, Tjiptasurasa Tri Ambar Nur Hidayat, Tri Ambar Nur Umar Umar Vanny M.A Tiwow Wahjoedi Wahjoedi Wahyuningsih Wahyuningsih Weni, Hastin WS Wigena, I.G.P. Yohanes Khristantyo, Yohanes YULIA PUJIASTUTI Yunita Yunita